Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EGFR-VSTM2A

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EGFR-VSTM2A
	FusionPDB ID: 25488
	FusionGDB2.0 ID: 25488
		Hgene	Tgene
	Gene symbol	EGFR	VSTM2A
	Gene ID	1956	222008
	Gene name	epidermal growth factor receptor	V-set and transmembrane domain containing 2A
	Synonyms	ERBB\|ERBB1\|HER1\|NISBD2\|PIG61\|mENA	VSTM2
	Cytomap	7p11.2	7p11.2
	Type of gene	protein-coding	protein-coding
	Description	epidermal growth factor receptoravian erythroblastic leukemia viral (v-erb-b) oncogene homologcell growth inhibiting protein 40cell proliferation-inducing protein 61epidermal growth factor receptor tyrosine kinase domainerb-b2 receptor tyrosine kinas	V-set and transmembrane domain-containing protein 2AV-set and transmembrane domain containing 2hypothetical protein MGC33530
	Modification date	20200329	20200313
	UniProtAcc	P00533 Main function of 5'-partner protein: FUNCTION: Receptor tyrosine kinase binding ligands of the EGF family and activating several signaling cascades to convert extracellular cues into appropriate cellular responses (PubMed:2790960, PubMed:10805725, PubMed:27153536). Known ligands include EGF, TGFA/TGF-alpha, AREG, epigen/EPGN, BTC/betacellulin, epiregulin/EREG and HBEGF/heparin-binding EGF (PubMed:2790960, PubMed:7679104, PubMed:8144591, PubMed:9419975, PubMed:15611079, PubMed:12297049, PubMed:27153536, PubMed:20837704, PubMed:17909029). Ligand binding triggers receptor homo- and/or heterodimerization and autophosphorylation on key cytoplasmic residues. The phosphorylated receptor recruits adapter proteins like GRB2 which in turn activates complex downstream signaling cascades. Activates at least 4 major downstream signaling cascades including the RAS-RAF-MEK-ERK, PI3 kinase-AKT, PLCgamma-PKC and STATs modules (PubMed:27153536). May also activate the NF-kappa-B signaling cascade (PubMed:11116146). Also directly phosphorylates other proteins like RGS16, activating its GTPase activity and probably coupling the EGF receptor signaling to the G protein-coupled receptor signaling (PubMed:11602604). Also phosphorylates MUC1 and increases its interaction with SRC and CTNNB1/beta-catenin (PubMed:11483589). Positively regulates cell migration via interaction with CCDC88A/GIV which retains EGFR at the cell membrane following ligand stimulation, promoting EGFR signaling which triggers cell migration (PubMed:20462955). Plays a role in enhancing learning and memory performance (By similarity). {ECO:0000250\|UniProtKB:Q01279, ECO:0000269\|PubMed:10805725, ECO:0000269\|PubMed:11116146, ECO:0000269\|PubMed:11483589, ECO:0000269\|PubMed:11602604, ECO:0000269\|PubMed:12297049, ECO:0000269\|PubMed:12297050, ECO:0000269\|PubMed:12620237, ECO:0000269\|PubMed:12873986, ECO:0000269\|PubMed:15374980, ECO:0000269\|PubMed:15590694, ECO:0000269\|PubMed:15611079, ECO:0000269\|PubMed:17115032, ECO:0000269\|PubMed:17909029, ECO:0000269\|PubMed:19560417, ECO:0000269\|PubMed:20462955, ECO:0000269\|PubMed:20837704, ECO:0000269\|PubMed:21258366, ECO:0000269\|PubMed:27153536, ECO:0000269\|PubMed:2790960, ECO:0000269\|PubMed:7679104, ECO:0000269\|PubMed:8144591, ECO:0000269\|PubMed:9419975}.; FUNCTION: Isoform 2 may act as an antagonist of EGF action.; FUNCTION: (Microbial infection) Acts as a receptor for hepatitis C virus (HCV) in hepatocytes and facilitates its cell entry. Mediates HCV entry by promoting the formation of the CD81-CLDN1 receptor complexes that are essential for HCV entry and by enhancing membrane fusion of cells expressing HCV envelope glycoproteins. {ECO:0000269\|PubMed:21516087}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000463948, ENST00000275493, ENST00000454757, ENST00000455089, ENST00000342916, ENST00000344576, ENST00000420316, ENST00000442591,	ENST00000302287, ENST00000402026, ENST00000402613, ENST00000404951, ENST00000407838, ENST00000498834,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	41 X 25 X 14=14350	3 X 2 X 4=24
	# samples	53	4
	** MAII score	log2(53/14350*10)=-4.75891456699985 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/24*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: EGFR [Title/Abstract] AND VSTM2A [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EGFR [Title/Abstract] AND VSTM2A [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EGFR(55270318)-VSTM2A(54636824), # samples:1 EGFR(55087058)-VSTM2A(54612315), # samples:1
Anticipated loss of major functional domain due to fusion event.	EGFR-VSTM2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EGFR-VSTM2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EGFR-VSTM2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EGFR-VSTM2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	EGFR	GO:0001934	positive regulation of protein phosphorylation	20551055
Hgene	EGFR	GO:0007165	signal transduction	10572067
Hgene	EGFR	GO:0007166	cell surface receptor signaling pathway	7736574
Hgene	EGFR	GO:0007173	epidermal growth factor receptor signaling pathway	7736574\|12435727
Hgene	EGFR	GO:0008283	cell proliferation	17115032
Hgene	EGFR	GO:0008284	positive regulation of cell proliferation	7736574
Hgene	EGFR	GO:0010750	positive regulation of nitric oxide mediated signal transduction	12828935
Hgene	EGFR	GO:0018108	peptidyl-tyrosine phosphorylation	22732145
Hgene	EGFR	GO:0030307	positive regulation of cell growth	15467833
Hgene	EGFR	GO:0042177	negative regulation of protein catabolic process	17115032
Hgene	EGFR	GO:0042327	positive regulation of phosphorylation	15082764
Hgene	EGFR	GO:0043406	positive regulation of MAP kinase activity	10572067
Hgene	EGFR	GO:0045739	positive regulation of DNA repair	17115032
Hgene	EGFR	GO:0045740	positive regulation of DNA replication	17115032
Hgene	EGFR	GO:0045944	positive regulation of transcription by RNA polymerase II	20551055
Hgene	EGFR	GO:0050679	positive regulation of epithelial cell proliferation	10572067
Hgene	EGFR	GO:0050999	regulation of nitric-oxide synthase activity	12828935
Hgene	EGFR	GO:0070141	response to UV-A	18483258
Hgene	EGFR	GO:0070374	positive regulation of ERK1 and ERK2 cascade	20551055
Hgene	EGFR	GO:0071392	cellular response to estradiol stimulus	20551055
Hgene	EGFR	GO:1900020	positive regulation of protein kinase C activity	22732145
Hgene	EGFR	GO:1903078	positive regulation of protein localization to plasma membrane	22732145

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:55270318/chr7:54636824)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EGFR (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across VSTM2A (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000455089	EGFR	chr7	55087058	+	ENST00000302287	VSTM2A	chr7	54612315	+	3261	345	257	1000	247
ENST00000455089	EGFR	chr7	55087058	+	ENST00000407838	VSTM2A	chr7	54612315	+	2972	345	257	976	239
ENST00000455089	EGFR	chr7	55087058	+	ENST00000404951	VSTM2A	chr7	54612315	+	2472	345	257	1195	312
ENST00000455089	EGFR	chr7	55087058	+	ENST00000402026	VSTM2A	chr7	54612315	+	3257	345	257	1000	247
ENST00000455089	EGFR	chr7	55087058	+	ENST00000402613	VSTM2A	chr7	54612315	+	1216	345	257	988	243
ENST00000342916	EGFR	chr7	55087058	+	ENST00000302287	VSTM2A	chr7	54612315	+	3250	334	246	989	247
ENST00000342916	EGFR	chr7	55087058	+	ENST00000407838	VSTM2A	chr7	54612315	+	2961	334	246	965	239
ENST00000342916	EGFR	chr7	55087058	+	ENST00000404951	VSTM2A	chr7	54612315	+	2461	334	246	1184	312
ENST00000342916	EGFR	chr7	55087058	+	ENST00000402026	VSTM2A	chr7	54612315	+	3246	334	246	989	247
ENST00000342916	EGFR	chr7	55087058	+	ENST00000402613	VSTM2A	chr7	54612315	+	1205	334	246	977	243
ENST00000344576	EGFR	chr7	55087058	+	ENST00000302287	VSTM2A	chr7	54612315	+	3249	333	245	988	247
ENST00000344576	EGFR	chr7	55087058	+	ENST00000407838	VSTM2A	chr7	54612315	+	2960	333	245	964	239
ENST00000344576	EGFR	chr7	55087058	+	ENST00000404951	VSTM2A	chr7	54612315	+	2460	333	245	1183	312
ENST00000344576	EGFR	chr7	55087058	+	ENST00000402026	VSTM2A	chr7	54612315	+	3245	333	245	988	247
ENST00000344576	EGFR	chr7	55087058	+	ENST00000402613	VSTM2A	chr7	54612315	+	1204	333	245	976	243
ENST00000420316	EGFR	chr7	55087058	+	ENST00000302287	VSTM2A	chr7	54612315	+	3248	332	244	987	247
ENST00000420316	EGFR	chr7	55087058	+	ENST00000407838	VSTM2A	chr7	54612315	+	2959	332	244	963	239
ENST00000420316	EGFR	chr7	55087058	+	ENST00000404951	VSTM2A	chr7	54612315	+	2459	332	244	1182	312
ENST00000420316	EGFR	chr7	55087058	+	ENST00000402026	VSTM2A	chr7	54612315	+	3244	332	244	987	247
ENST00000420316	EGFR	chr7	55087058	+	ENST00000402613	VSTM2A	chr7	54612315	+	1203	332	244	975	243
ENST00000275493	EGFR	chr7	55087058	+	ENST00000302287	VSTM2A	chr7	54612315	+	3181	265	177	920	247
ENST00000275493	EGFR	chr7	55087058	+	ENST00000407838	VSTM2A	chr7	54612315	+	2892	265	177	896	239
ENST00000275493	EGFR	chr7	55087058	+	ENST00000404951	VSTM2A	chr7	54612315	+	2392	265	177	1115	312
ENST00000275493	EGFR	chr7	55087058	+	ENST00000402026	VSTM2A	chr7	54612315	+	3177	265	177	920	247
ENST00000275493	EGFR	chr7	55087058	+	ENST00000402613	VSTM2A	chr7	54612315	+	1136	265	177	908	243
ENST00000442591	EGFR	chr7	55087058	+	ENST00000302287	VSTM2A	chr7	54612315	+	3164	248	160	903	247
ENST00000442591	EGFR	chr7	55087058	+	ENST00000407838	VSTM2A	chr7	54612315	+	2875	248	160	879	239
ENST00000442591	EGFR	chr7	55087058	+	ENST00000404951	VSTM2A	chr7	54612315	+	2375	248	160	1098	312
ENST00000442591	EGFR	chr7	55087058	+	ENST00000402026	VSTM2A	chr7	54612315	+	3160	248	160	903	247
ENST00000442591	EGFR	chr7	55087058	+	ENST00000402613	VSTM2A	chr7	54612315	+	1119	248	160	891	243

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000455089	ENST00000302287	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001529616	0.99847037
ENST00000455089	ENST00000407838	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.002019438	0.99798054
ENST00000455089	ENST00000404951	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.00522875	0.9947713
ENST00000455089	ENST00000402026	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001601054	0.99839896
ENST00000455089	ENST00000402613	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.009869208	0.9901308
ENST00000342916	ENST00000302287	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.00153654	0.9984635
ENST00000342916	ENST00000407838	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.002057799	0.99794215
ENST00000342916	ENST00000404951	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.005190971	0.99480903
ENST00000342916	ENST00000402026	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001608329	0.9983917
ENST00000342916	ENST00000402613	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.011380062	0.9886199
ENST00000344576	ENST00000302287	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001521211	0.99847883
ENST00000344576	ENST00000407838	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001889307	0.99811065
ENST00000344576	ENST00000404951	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.005123856	0.9948762
ENST00000344576	ENST00000402026	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001592269	0.9984078
ENST00000344576	ENST00000402613	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.010821592	0.9891784
ENST00000420316	ENST00000302287	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001514362	0.9984856
ENST00000420316	ENST00000407838	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001842511	0.99815744
ENST00000420316	ENST00000404951	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.005049009	0.994951
ENST00000420316	ENST00000402026	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.00158509	0.9984149
ENST00000420316	ENST00000402613	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.010487601	0.9895124
ENST00000275493	ENST00000302287	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001306733	0.9986933
ENST00000275493	ENST00000407838	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001929868	0.9980702
ENST00000275493	ENST00000404951	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.004682067	0.99531794
ENST00000275493	ENST00000402026	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001368795	0.9986312
ENST00000275493	ENST00000402613	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.010642058	0.989358
ENST00000442591	ENST00000302287	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001259206	0.99874085
ENST00000442591	ENST00000407838	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001848529	0.9981515
ENST00000442591	ENST00000404951	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.00444001	0.99555993
ENST00000442591	ENST00000402026	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.001319353	0.99868065
ENST00000442591	ENST00000402613	EGFR	chr7	55087058	+	VSTM2A	chr7	54612315	+	0.011472977	0.98852706

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EGFR-VSTM2A

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EGFR	chr7	55087058	VSTM2A	chr7	54612315	248	29	ALCPASRALEEKKAKFTEFPRNVTAT
EGFR	chr7	55087058	VSTM2A	chr7	54612315	265	29	ALCPASRALEEKKAKFTEFPRNVTAT
EGFR	chr7	55087058	VSTM2A	chr7	54612315	332	29	ALCPASRALEEKKAKFTEFPRNVTAT
EGFR	chr7	55087058	VSTM2A	chr7	54612315	333	29	ALCPASRALEEKKAKFTEFPRNVTAT
EGFR	chr7	55087058	VSTM2A	chr7	54612315	334	29	ALCPASRALEEKKAKFTEFPRNVTAT
EGFR	chr7	55087058	VSTM2A	chr7	54612315	345	29	ALCPASRALEEKKAKFTEFPRNVTAT

Top

Potential FusionNeoAntigen Information of EGFR-VSTM2A in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EGFR-VSTM2A_55087058_54612315.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B15:03	KKAKFTEF	0.9719	0.8751	11	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B14:01	EKKAKFTEF	0.9243	0.7359	10	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B14:02	EKKAKFTEF	0.9243	0.7359	10	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B08:09	EKKAKFTEF	0.8783	0.5933	10	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B44:03	EEKKAKFTEF	0.9834	0.905	9	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B18:01	EEKKAKFTEF	0.8497	0.8183	9	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B73:01	SRALEEKKA	0.9501	0.6358	5	14
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B14:03	EKKAKFTEF	0.1299	0.9054	10	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B15:68	KKAKFTEF	0.9849	0.7857	11	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-A30:01	RALEEKKAK	0.9612	0.9108	6	15
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B08:12	EKKAKFTEF	0.8189	0.6607	10	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B15:68	EKKAKFTEF	0.4341	0.5894	10	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B15:54	EKKAKFTEF	0.3312	0.7672	10	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B08:12	ALEEKKAKF	0.16	0.9316	7	16
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B44:07	EEKKAKFTEF	0.9834	0.905	9	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B44:13	EEKKAKFTEF	0.9834	0.905	9	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B44:26	EEKKAKFTEF	0.9834	0.905	9	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B18:11	EEKKAKFTEF	0.8988	0.7884	9	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B18:08	EEKKAKFTEF	0.8647	0.7819	9	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B18:05	EEKKAKFTEF	0.8497	0.8183	9	19
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	HLA-B18:03	EEKKAKFTEF	0.8161	0.8155	9	19

Top

Potential FusionNeoAntigen Information of EGFR-VSTM2A in HLA II

EGFR-VSTM2A_55087058_54612315.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1111	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1114	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1119	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1120	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1131	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1145	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1169	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1169	EKKAKFTEFPRNVTA	10	25
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1182	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1182	EKKAKFTEFPRNVTA	10	25
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1302	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1323	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1334	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1336	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1339	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1363	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1373	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1374	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1382	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1397	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1399	KKAKFTEFPRNVTAT	11	26
EGFR-VSTM2A	chr7	55087058	chr7	54612315	265	DRB1-1424	KKAKFTEFPRNVTAT	11	26

Top

Fusion breakpoint peptide structures of EGFR-VSTM2A

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7692	RALEEKKAKFTEFP	EGFR	VSTM2A	chr7	55087058	chr7	54612315	265

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EGFR-VSTM2A

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7692	RALEEKKAKFTEFP	-8.15586	-8.26996
HLA-B14:02	3BVN	7692	RALEEKKAKFTEFP	-5.73711	-6.76931
HLA-B52:01	3W39	7692	RALEEKKAKFTEFP	-5.54485	-5.65895
HLA-B52:01	3W39	7692	RALEEKKAKFTEFP	-5.39654	-6.42874
HLA-A11:01	4UQ2	7692	RALEEKKAKFTEFP	-5.46627	-5.58037
HLA-A24:02	5HGA	7692	RALEEKKAKFTEFP	-6.59869	-6.71279
HLA-A24:02	5HGA	7692	RALEEKKAKFTEFP	-5.87681	-6.90901
HLA-B44:05	3DX8	7692	RALEEKKAKFTEFP	-6.71266	-6.82676
HLA-B44:05	3DX8	7692	RALEEKKAKFTEFP	-6.35863	-7.39083

Top

Vaccine Design for the FusionNeoAntigens of EGFR-VSTM2A

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EGFR-VSTM2A	chr7	55087058	chr7	54612315	10	19	EKKAKFTEF	AAAAGAAAGCAAAATTTACCGAGTTTC
EGFR-VSTM2A	chr7	55087058	chr7	54612315	11	19	KKAKFTEF	AGAAAGCAAAATTTACCGAGTTTC
EGFR-VSTM2A	chr7	55087058	chr7	54612315	5	14	SRALEEKKA	GTCGGGCTCTGGAGGAAAAGAAAGCAA
EGFR-VSTM2A	chr7	55087058	chr7	54612315	6	15	RALEEKKAK	GGGCTCTGGAGGAAAAGAAAGCAAAAT
EGFR-VSTM2A	chr7	55087058	chr7	54612315	7	16	ALEEKKAKF	CTCTGGAGGAAAAGAAAGCAAAATTTA
EGFR-VSTM2A	chr7	55087058	chr7	54612315	9	19	EEKKAKFTEF	AGGAAAAGAAAGCAAAATTTACCGAGTTTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
EGFR-VSTM2A	chr7	55087058	chr7	54612315	10	25	EKKAKFTEFPRNVTA	AAAAGAAAGCAAAATTTACCGAGTTTCCGCGGAACGTGACGGCGA
EGFR-VSTM2A	chr7	55087058	chr7	54612315	11	26	KKAKFTEFPRNVTAT	AGAAAGCAAAATTTACCGAGTTTCCGCGGAACGTGACGGCGACCG

Top

Information of the samples that have these potential fusion neoantigens of EGFR-VSTM2A

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
GBM	EGFR-VSTM2A	chr7	55087058	ENST00000275493	chr7	54612315	ENST00000302287	TCGA-12-5299-01A

Top

Potential target of CAR-T therapy development for EGFR-VSTM2A

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EGFR-VSTM2A

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EGFR-VSTM2A

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)