![]() |
|||||||
|
Fusion Protein:EHHADH-ABCC5 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: EHHADH-ABCC5 | FusionPDB ID: 25574 | FusionGDB2.0 ID: 25574 | Hgene | Tgene | Gene symbol | EHHADH | ABCC5 | Gene ID | 1962 | 10057 |
Gene name | enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase | ATP binding cassette subfamily C member 5 | |
Synonyms | ECHD|FRTS3|L-PBE|LBFP|LBP|PBFE | ABC33|EST277145|MOAT-C|MOATC|MRP5|SMRP|pABC11 | |
Cytomap | 3q27.2 | 3q27.1 | |
Type of gene | protein-coding | protein-coding | |
Description | peroxisomal bifunctional enzyme3,2-trans-enoyl-CoA isomeraseL-3-hydroxyacyl-CoA dehydrogenaseL-bifunctional protein, peroxisomalPBEenoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenaseenoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase | multidrug resistance-associated protein 5ATP-binding cassette, sub-family C (CFTR/MRP), member 5canalicular multispecific organic anion transporter Cmulti-specific organic anion transporter C | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | Q08426 Main function of 5'-partner protein: FUNCTION: Peroxisomal trifunctional enzyme possessing 2-enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase, and delta 3, delta 2-enoyl-CoA isomerase activities. Catalyzes two of the four reactions of the long straight chain fatty acids peroxisomal beta-oxidation pathway. Optimal isomerase for 2,5 double bonds into 3,5 form isomerization in a range of enoyl-CoA species (Probable). Also able to isomerize both 3-cis and 3-trans double bonds into the 2-trans form in a range of enoyl-CoA species (By similarity). With HSD17B4, catalyzes the hydration of trans-2-enoyl-CoA and the dehydrogenation of 3-hydroxyacyl-CoA, but with opposite chiral specificity (PubMed:15060085). Regulates the amount of medium-chain dicarboxylic fatty acids which are essential regulators of all fatty acid oxidation pathways (By similarity). Also involved in the degradation of long-chain dicarboxylic acids through peroxisomal beta-oxidation (PubMed:15060085). {ECO:0000250|UniProtKB:P07896, ECO:0000250|UniProtKB:Q9DBM2, ECO:0000269|PubMed:15060085, ECO:0000305|PubMed:15060085}. | O15440 Main function of 5'-partner protein: FUNCTION: Acts as a multispecific organic anion pump which can transport nucleotide analogs. Heme transporter required for the translocation of cytosolic heme to the secretory pathway (PubMed:24836561). {ECO:0000269|PubMed:10840050, ECO:0000269|PubMed:24836561}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000231887, ENST00000456310, ENST00000440662, ENST00000475987, | ENST00000492216, ENST00000382494, ENST00000392579, ENST00000427120, ENST00000446941, ENST00000265586, ENST00000334444, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 2 X 2 X 2=8 | 6 X 7 X 6=252 |
# samples | 2 | 9 | |
** MAII score | log2(2/8*10)=1.32192809488736 | log2(9/252*10)=-1.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: EHHADH [Title/Abstract] AND ABCC5 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: EHHADH [Title/Abstract] AND ABCC5 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | EHHADH(184922204)-ABCC5(183696439), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | EHHADH-ABCC5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EHHADH-ABCC5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EHHADH-ABCC5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EHHADH-ABCC5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EHHADH-ABCC5 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. EHHADH-ABCC5 seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. EHHADH-ABCC5 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | EHHADH | GO:0006475 | internal protein amino acid acetylation | 20167786 |
Tgene | ABCC5 | GO:0042908 | xenobiotic transport | 10840050 |
Tgene | ABCC5 | GO:0140115 | export across plasma membrane | 10840050 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:184922204/chr3:183696439) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000231887 | EHHADH | chr3 | 184922204 | - | ENST00000334444 | ABCC5 | chr3 | 183696439 | - | 5519 | 986 | 34 | 4152 | 1372 |
ENST00000231887 | EHHADH | chr3 | 184922204 | - | ENST00000265586 | ABCC5 | chr3 | 183696439 | - | 4110 | 986 | 34 | 4023 | 1329 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000231887 | ENST00000334444 | EHHADH | chr3 | 184922204 | - | ABCC5 | chr3 | 183696439 | - | 0.00083297 | 0.9991671 |
ENST00000231887 | ENST00000265586 | EHHADH | chr3 | 184922204 | - | ABCC5 | chr3 | 183696439 | - | 0.002356549 | 0.9976434 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for EHHADH-ABCC5 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
EHHADH | chr3 | 184922204 | ABCC5 | chr3 | 183696439 | 986 | 317 | TASARPVSSVGVVEIREEERRILEKA |
Top |
Potential FusionNeoAntigen Information of EHHADH-ABCC5 in HLA I |
![]() |
EHHADH-ABCC5_184922204_183696439.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | HLA-B15:16 | VSSVGVVEI | 0.9912 | 0.5722 | 6 | 15 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | HLA-C15:06 | VSSVGVVEI | 0.9995 | 0.9232 | 6 | 15 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | HLA-C06:03 | VSSVGVVEI | 0.9663 | 0.9766 | 6 | 15 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | HLA-C02:06 | VSSVGVVEI | 0.5796 | 0.9712 | 6 | 15 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | HLA-C15:02 | VSSVGVVEI | 0.9995 | 0.8551 | 6 | 15 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | HLA-C15:05 | VSSVGVVEI | 0.9995 | 0.7885 | 6 | 15 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | HLA-C16:02 | VSSVGVVEI | 0.9225 | 0.9769 | 6 | 15 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | HLA-C17:01 | VSSVGVVEI | 0.6867 | 0.8035 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of EHHADH-ABCC5 in HLA II |
![]() |
EHHADH-ABCC5_184922204_183696439.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1113 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1113 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1192 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1309 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1327 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1343 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1343 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1354 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1354 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1361 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1371 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1401 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1416 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1416 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1418 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1426 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1432 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1432 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1434 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1435 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1435 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1437 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1438 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1438 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1454 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1455 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1455 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1458 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1460 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1464 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1465 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1465 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1472 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1481 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1482 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1482 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1486 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1487 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1488 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1490 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1495 | VVEIREEERRILEKA | 11 | 26 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1495 | GVVEIREEERRILEK | 10 | 25 |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 | DRB1-1497 | VVEIREEERRILEKA | 11 | 26 |
Top |
Fusion breakpoint peptide structures of EHHADH-ABCC5 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
10294 | VSSVGVVEIREEER | EHHADH | ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 986 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EHHADH-ABCC5 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 10294 | VSSVGVVEIREEER | -4.62424 | -5.65954 |
HLA-B14:02 | 3BVN | 10294 | VSSVGVVEIREEER | -4.1114 | -4.2248 |
HLA-B52:01 | 3W39 | 10294 | VSSVGVVEIREEER | -6.8001 | -6.9135 |
HLA-B52:01 | 3W39 | 10294 | VSSVGVVEIREEER | -6.46104 | -7.49634 |
HLA-A24:02 | 5HGA | 10294 | VSSVGVVEIREEER | -9.1447 | -9.2581 |
HLA-A24:02 | 5HGA | 10294 | VSSVGVVEIREEER | -6.01279 | -7.04809 |
HLA-B44:05 | 3DX8 | 10294 | VSSVGVVEIREEER | -5.02862 | -5.14202 |
HLA-B44:05 | 3DX8 | 10294 | VSSVGVVEIREEER | -4.60714 | -5.64244 |
HLA-B35:01 | 1A1N | 10294 | VSSVGVVEIREEER | -6.96036 | -7.07376 |
HLA-B35:01 | 1A1N | 10294 | VSSVGVVEIREEER | -5.80044 | -6.83574 |
Top |
Vaccine Design for the FusionNeoAntigens of EHHADH-ABCC5 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 6 | 15 | VSSVGVVEI | TCTCCTCAGTTGGTGTTGTTGAAATCC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 10 | 25 | GVVEIREEERRILEK | GTGTTGTTGAAATCCGCGAGGAGGAGCGTCGGATATTGGAAAAAG |
EHHADH-ABCC5 | chr3 | 184922204 | chr3 | 183696439 | 11 | 26 | VVEIREEERRILEKA | TTGTTGAAATCCGCGAGGAGGAGCGTCGGATATTGGAAAAAGCTG |
Top |
Information of the samples that have these potential fusion neoantigens of EHHADH-ABCC5 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | EHHADH-ABCC5 | chr3 | 184922204 | ENST00000231887 | chr3 | 183696439 | ENST00000265586 | TCGA-D8-A27N-01A |
Top |
Potential target of CAR-T therapy development for EHHADH-ABCC5 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 1018_1038 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 1104_1124 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 1127_1147 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 400_420 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 434_454 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 608_628 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 848_868 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 917_937 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000334444 | 7 | 30 | 997_1017 | 0 | 1438.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 1018_1038 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 1104_1124 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 1127_1147 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 179_199 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 219_239 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 296_316 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 317_337 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 400_420 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 434_454 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 608_628 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 848_868 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 917_937 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000382494 | 0 | 7 | 997_1017 | 0 | 533.3333333333334 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 1018_1038 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 1104_1124 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 1127_1147 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 179_199 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 219_239 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 296_316 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 317_337 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 400_420 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 434_454 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 608_628 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 848_868 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 917_937 | 0 | 226.0 | Transmembrane | Helical | |
Tgene | ABCC5 | chr3:184922204 | chr3:183696439 | ENST00000392579 | 0 | 6 | 997_1017 | 0 | 226.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
EHHADH | chr3 | 184922204 | ENST00000231887 | ABCC5 | chr3 | 183696439 | ENST00000265586 | ![]() |
EHHADH | chr3 | 184922204 | ENST00000231887 | ABCC5 | chr3 | 183696439 | ENST00000334444 | ![]() |
Top |
Related Drugs to EHHADH-ABCC5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to EHHADH-ABCC5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |