Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EIF3H-ANKH

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EIF3H-ANKH
	FusionPDB ID: 25846
	FusionGDB2.0 ID: 25846
		Hgene	Tgene
	Gene symbol	EIF3H	ANKH
	Gene ID	8667	56172
	Gene name	eukaryotic translation initiation factor 3 subunit H	ANKH inorganic pyrophosphate transport regulator
	Synonyms	EIF3S3\|eIF3-gamma\|eIF3-p40	ANK\|CCAL2\|CMDJ\|CPPDD\|HANK\|MANK\|SLC62A1
	Cytomap	8q23.3-q24.11	5p15.2
	Type of gene	protein-coding	protein-coding
	Description	eukaryotic translation initiation factor 3 subunit HeIF-3-gammaeIF3 p40 subuniteukaryotic translation initiation factor 3 subunit 3eukaryotic translation initiation factor 3, subunit 2 (beta, 36kD)eukaryotic translation initiation factor 3, subunit 3	progressive ankylosis protein homologankylosis, progressive homolog
	Modification date	20200313	20200313
	UniProtAcc	O15372 Main function of 5'-partner protein: FUNCTION: Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773). {ECO:0000255\|HAMAP-Rule:MF_03007, ECO:0000269\|PubMed:17581632, ECO:0000269\|PubMed:25849773, ECO:0000269\|PubMed:27462815}.	Q8IWZ3 Main function of 5'-partner protein: FUNCTION: May play a role as a scaffolding protein that may be associated with the abnormal phenotype of leukemia cells. Isoform 2 may possess an antiapoptotic effect and protect cells during normal cell survival through its regulation of caspases. {ECO:0000269\|PubMed:16098192}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000276682, ENST00000521861,	ENST00000503939, ENST00000284268, ENST00000535119,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	17 X 17 X 5=1445	13 X 11 X 7=1001
	# samples	23	14
	** MAII score	log2(23/1445*10)=-2.65136372644367 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/1001*10)=-2.83794324189103 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: EIF3H [Title/Abstract] AND ANKH [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EIF3H [Title/Abstract] AND ANKH [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EIF3H(117767905)-ANKH(14716944), # samples:1
Anticipated loss of major functional domain due to fusion event.	EIF3H-ANKH seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EIF3H-ANKH seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	EIF3H	GO:0006413	translational initiation	17581632

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:117767905/chr5:14716944)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EIF3H (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ANKH (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000521861	EIF3H	chr8	117767905	-	ENST00000284268	ANKH	chr5	14716944	-	7017	156	12	623	203
ENST00000521861	EIF3H	chr8	117767905	-	ENST00000535119	ANKH	chr5	14716944	-	1411	156	12	623	203
ENST00000276682	EIF3H	chr8	117767905	-	ENST00000284268	ANKH	chr5	14716944	-	7802	941	767	1408	213
ENST00000276682	EIF3H	chr8	117767905	-	ENST00000535119	ANKH	chr5	14716944	-	2196	941	767	1408	213

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000521861	ENST00000284268	EIF3H	chr8	117767905	-	ANKH	chr5	14716944	-	0.002134799	0.99786526
ENST00000521861	ENST00000535119	EIF3H	chr8	117767905	-	ANKH	chr5	14716944	-	0.001701736	0.9982982
ENST00000276682	ENST00000284268	EIF3H	chr8	117767905	-	ANKH	chr5	14716944	-	0.002745202	0.9972548
ENST00000276682	ENST00000535119	EIF3H	chr8	117767905	-	ANKH	chr5	14716944	-	0.003078588	0.9969214

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EIF3H-ANKH

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EIF3H	chr8	117767905	ANKH	chr5	14716944	156	48	GDSAVKQVQIDGLLCFVMFWTPNVSE
EIF3H	chr8	117767905	ANKH	chr5	14716944	941	58	GDSAVKQVQIDGLLCFVMFWTPNVSE

Top

Potential FusionNeoAntigen Information of EIF3H-ANKH in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EIF3H-ANKH_117767905_14716944.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:01	VQIDGLLCF	0.9987	0.9574	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:25	VQIDGLLCF	0.9575	0.963	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:02	VQIDGLLCF	0.9429	0.9667	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A24:15	VQIDGLLCF	0.9084	0.691	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:03	VQIDGLLCF	0.8752	0.8965	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B46:01	VQIDGLLCF	0.8185	0.6152	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:18	VQIDGLLCF	0.785	0.8575	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B47:01	VQIDGLLCF	0.7793	0.7006	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B48:01	VQIDGLLCF	0.7487	0.7374	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A24:14	VQIDGLLCF	0.7181	0.6792	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A32:13	VQIDGLLCF	0.7019	0.9785	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B13:01	VQIDGLLCF	0.6303	0.9791	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B39:13	KQVQIDGLL	0.5964	0.7503	5	14
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B13:02	KQVQIDGLL	0.5885	0.5683	5	14
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B13:01	KQVQIDGLL	0.5553	0.7157	5	14
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B39:13	VQIDGLLCF	0.3975	0.9879	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B52:01	VQIDGLLCF	0.077	0.9589	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:01	QVQIDGLLCF	0.9936	0.9683	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A02:21	VQIDGLLCFV	0.9928	0.6548	7	17
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:25	QVQIDGLLCF	0.9684	0.9725	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B13:02	VQIDGLLCFV	0.6997	0.9392	7	17
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B13:01	QVQIDGLLCF	0.4066	0.989	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:01	KQVQIDGLLCF	0.9999	0.9628	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B13:01	KQVQIDGLLCF	0.9821	0.9763	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:03	KQVQIDGLLCF	0.9583	0.8784	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:25	KQVQIDGLLCF	0.957	0.9542	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:07	VQIDGLLCF	0.9964	0.9015	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:04	VQIDGLLCF	0.9798	0.9777	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A02:07	QIDGLLCFV	0.9635	0.6762	8	17
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-C12:16	VQIDGLLCF	0.9442	0.9884	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:21	VQIDGLLCF	0.9402	0.9536	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:05	VQIDGLLCF	0.8605	0.951	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-C03:14	VQIDGLLCF	0.8154	0.9925	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:31	VQIDGLLCF	0.8119	0.9559	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-C07:46	VQIDGLLCF	0.7738	0.9609	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B48:03	VQIDGLLCF	0.4654	0.5693	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A02:05	VQIDGLLCFV	0.996	0.5991	7	17
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:05	QVQIDGLLCF	0.8852	0.9563	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:07	KQVQIDGLLCF	0.9993	0.9024	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:05	KQVQIDGLLCF	0.9677	0.8759	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:33	VQIDGLLCF	0.9987	0.9574	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:34	VQIDGLLCF	0.9987	0.9574	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:125	VQIDGLLCF	0.9987	0.9574	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:135	VQIDGLLCF	0.9987	0.9557	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:27	VQIDGLLCF	0.9987	0.9617	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:24	VQIDGLLCF	0.9986	0.9608	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:50	VQIDGLLCF	0.9983	0.9748	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:53	VQIDGLLCF	0.9971	0.9479	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:35	VQIDGLLCF	0.9962	0.9602	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:12	VQIDGLLCF	0.9869	0.9597	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:54	VQIDGLLCF	0.9763	0.9446	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:68	VQIDGLLCF	0.967	0.8733	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-C12:02	VQIDGLLCF	0.9644	0.9891	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:39	VQIDGLLCF	0.9612	0.9246	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:73	VQIDGLLCF	0.9428	0.9642	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:30	VQIDGLLCF	0.9112	0.9422	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A32:01	VQIDGLLCF	0.9038	0.9761	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:13	VQIDGLLCF	0.8964	0.8472	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-C03:02	VQIDGLLCF	0.8819	0.9832	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:20	VQIDGLLCF	0.8573	0.9674	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B35:28	VQIDGLLCF	0.8345	0.9685	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-C07:17	VQIDGLLCF	0.8338	0.9839	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:73	KQVQIDGLL	0.8283	0.7272	5	14
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B35:20	VQIDGLLCF	0.7831	0.9714	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B48:02	VQIDGLLCF	0.7332	0.9664	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B39:02	KQVQIDGLL	0.7244	0.7399	5	14
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A02:14	VQIDGLLCF	0.7205	0.6495	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B40:21	VQIDGLLCF	0.6769	0.6928	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:30	KQVQIDGLL	0.605	0.6676	5	14
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B18:04	VQIDGLLCF	0.5824	0.9673	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-C02:02	VQIDGLLCF	0.4668	0.99	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-C02:10	VQIDGLLCF	0.4668	0.99	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B40:12	VQIDGLLCF	0.4654	0.5693	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B18:08	VQIDGLLCF	0.4098	0.9466	7	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:53	QVQIDGLLCF	0.9943	0.9641	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:135	QVQIDGLLCF	0.9941	0.9699	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:33	QVQIDGLLCF	0.9936	0.9683	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:125	QVQIDGLLCF	0.9936	0.9683	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:34	QVQIDGLLCF	0.9936	0.9683	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:24	QVQIDGLLCF	0.9935	0.9803	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:27	QVQIDGLLCF	0.9932	0.9772	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A02:06	VQIDGLLCFV	0.9928	0.6548	7	17
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-A02:14	VQIDGLLCFV	0.9928	0.6284	7	17
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:54	QVQIDGLLCF	0.9883	0.9598	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:50	QVQIDGLLCF	0.9868	0.9796	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:12	QVQIDGLLCF	0.9759	0.9504	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:39	QVQIDGLLCF	0.9683	0.942	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:20	QVQIDGLLCF	0.8815	0.9714	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B35:28	QVQIDGLLCF	0.8693	0.9735	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B48:02	QVQIDGLLCF	0.7981	0.9677	6	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:33	KQVQIDGLLCF	0.9999	0.9628	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:27	KQVQIDGLLCF	0.9999	0.9734	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:135	KQVQIDGLLCF	0.9999	0.9615	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:125	KQVQIDGLLCF	0.9999	0.9628	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:24	KQVQIDGLLCF	0.9999	0.9698	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:34	KQVQIDGLLCF	0.9999	0.9628	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:50	KQVQIDGLLCF	0.9999	0.9763	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:35	KQVQIDGLLCF	0.9985	0.9675	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:53	KQVQIDGLLCF	0.9984	0.9593	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:73	VQIDGLLCFVM	0.9976	0.9929	7	18
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:30	VQIDGLLCFVM	0.9967	0.9856	7	18
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:54	KQVQIDGLLCF	0.9861	0.952	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B48:02	KQVQIDGLLCF	0.9696	0.8932	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:39	KQVQIDGLLCF	0.9694	0.9144	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B15:20	KQVQIDGLLCF	0.9636	0.905	5	16
EIF3H-ANKH	chr8	117767905	chr5	14716944	941	HLA-B35:28	KQVQIDGLLCF	0.9589	0.9085	5	16

Top

Potential FusionNeoAntigen Information of EIF3H-ANKH in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of EIF3H-ANKH

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7631	QVQIDGLLCFVMFW	EIF3H	ANKH	chr8	117767905	chr5	14716944	941

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EIF3H-ANKH

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7631	QVQIDGLLCFVMFW	-7.15543	-7.26883
HLA-B14:02	3BVN	7631	QVQIDGLLCFVMFW	-4.77435	-5.80965
HLA-B52:01	3W39	7631	QVQIDGLLCFVMFW	-6.80875	-6.92215
HLA-B52:01	3W39	7631	QVQIDGLLCFVMFW	-4.20386	-5.23916
HLA-A11:01	4UQ2	7631	QVQIDGLLCFVMFW	-7.5194	-8.5547
HLA-A11:01	4UQ2	7631	QVQIDGLLCFVMFW	-6.9601	-7.0735
HLA-A24:02	5HGA	7631	QVQIDGLLCFVMFW	-7.52403	-7.63743
HLA-A24:02	5HGA	7631	QVQIDGLLCFVMFW	-5.82433	-6.85963
HLA-B27:05	6PYJ	7631	QVQIDGLLCFVMFW	-3.28285	-4.31815
HLA-B44:05	3DX8	7631	QVQIDGLLCFVMFW	-5.91172	-6.94702
HLA-B44:05	3DX8	7631	QVQIDGLLCFVMFW	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of EIF3H-ANKH

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EIF3H-ANKH	chr8	117767905	chr5	14716944	5	14	KQVQIDGLL	AAGCAAGTGCAGATAGATGGCCTTCTC
EIF3H-ANKH	chr8	117767905	chr5	14716944	5	16	KQVQIDGLLCF	AAGCAAGTGCAGATAGATGGCCTTCTCTGTTTC
EIF3H-ANKH	chr8	117767905	chr5	14716944	6	16	QVQIDGLLCF	CAAGTGCAGATAGATGGCCTTCTCTGTTTC
EIF3H-ANKH	chr8	117767905	chr5	14716944	7	16	VQIDGLLCF	GTGCAGATAGATGGCCTTCTCTGTTTC
EIF3H-ANKH	chr8	117767905	chr5	14716944	7	17	VQIDGLLCFV	GTGCAGATAGATGGCCTTCTCTGTTTCGTG
EIF3H-ANKH	chr8	117767905	chr5	14716944	7	18	VQIDGLLCFVM	GTGCAGATAGATGGCCTTCTCTGTTTCGTGATG
EIF3H-ANKH	chr8	117767905	chr5	14716944	8	17	QIDGLLCFV	CAGATAGATGGCCTTCTCTGTTTCGTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of EIF3H-ANKH

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	EIF3H-ANKH	chr8	117767905	ENST00000276682	chr5	14716944	ENST00000284268	TCGA-D7-5577-01A

Top

Potential target of CAR-T therapy development for EIF3H-ANKH

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

ANKH

chr8:117767905

chr5:14716944

ENST00000284268

351_371

493.0

Transmembrane

Helical

Tgene

ANKH

chr8:117767905

chr5:14716944

ENST00000284268

404_426

493.0

Transmembrane

Helical

Tgene

ANKH

chr8:117767905

chr5:14716944

ENST00000284268

430_452

493.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EIF3H-ANKH

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EIF3H-ANKH

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)