Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EME1-ERBB2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EME1-ERBB2
	FusionPDB ID: 26396
	FusionGDB2.0 ID: 26396
		Hgene	Tgene
	Gene symbol	EME1	ERBB2
	Gene ID	146956	2064
	Gene name	essential meiotic structure-specific endonuclease 1	erb-b2 receptor tyrosine kinase 2
	Synonyms	MMS4L\|SLX2A	CD340\|HER-2\|HER-2/neu\|HER2\|MLN 19\|NEU\|NGL\|TKR1
	Cytomap	17q21.33	17q12
	Type of gene	protein-coding	protein-coding
	Description	crossover junction endonuclease EME1MMS4 homologSLX2 structure-specific endonuclease subunit homolog Aessential meiotic endonuclease 1 homolog 1essential meiotic endonuclease 1 homolog 2hMMS4homolog of yeast EME1 endonuclease	receptor tyrosine-protein kinase erbB-2c-erb B2/neu proteinherstatinhuman epidermal growth factor receptor 2metastatic lymph node gene 19 proteinneuro/glioblastoma derived oncogene homologneuroblastoma/glioblastoma derived oncogene homologp185erbB2
	Modification date	20200313	20200329
	UniProtAcc	Q96AY2 Main function of 5'-partner protein: FUNCTION: Interacts with MUS81 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick. Typical substrates include 3'-flap structures, replication forks and nicked Holliday junctions. May be required in mitosis for the processing of stalled or collapsed replication forks. {ECO:0000269\|PubMed:12686547, ECO:0000269\|PubMed:12721304, ECO:0000269\|PubMed:14617801, ECO:0000269\|PubMed:17289582}.	P04626 Main function of 5'-partner protein: FUNCTION: Protein tyrosine kinase that is part of several cell surface receptor complexes, but that apparently needs a coreceptor for ligand binding. Essential component of a neuregulin-receptor complex, although neuregulins do not interact with it alone. GP30 is a potential ligand for this receptor. Regulates outgrowth and stabilization of peripheral microtubules (MTs). Upon ERBB2 activation, the MEMO1-RHOA-DIAPH1 signaling pathway elicits the phosphorylation and thus the inhibition of GSK3B at cell membrane. This prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. {ECO:0000305}.; FUNCTION: In the nucleus is involved in transcriptional regulation. Associates with the 5'-TCAAATTC-3' sequence in the PTGS2/COX-2 promoter and activates its transcription. Implicated in transcriptional activation of CDKN1A; the function involves STAT3 and SRC. Involved in the transcription of rRNA genes by RNA Pol I and enhances protein synthesis and cell growth. {ECO:0000269\|PubMed:10358079, ECO:0000269\|PubMed:15380516, ECO:0000269\|PubMed:21555369}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000338165, ENST00000393271, ENST00000511648,	ENST00000540042, ENST00000578199, ENST00000584888, ENST00000269571, ENST00000406381, ENST00000445658, ENST00000540147, ENST00000541774, ENST00000584450, ENST00000584601,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 2 X 1=4	34 X 40 X 10=13600
	# samples	2	43
	** MAII score	log2(2/4*10)=2.32192809488736	log2(43/13600*10)=-4.9831261814356 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: EME1 [Title/Abstract] AND ERBB2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EME1 [Title/Abstract] AND ERBB2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EME1(48452873)-ERBB2(37882815), # samples:1
Anticipated loss of major functional domain due to fusion event.	EME1-ERBB2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EME1-ERBB2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EME1-ERBB2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EME1-ERBB2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ERBB2	GO:0007165	signal transduction	10572067
Tgene	ERBB2	GO:0007166	cell surface receptor signaling pathway	9685399
Tgene	ERBB2	GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	7514177
Tgene	ERBB2	GO:0014065	phosphatidylinositol 3-kinase signaling	7556068
Tgene	ERBB2	GO:0018108	peptidyl-tyrosine phosphorylation	12000754
Tgene	ERBB2	GO:0032886	regulation of microtubule-based process	20937854
Tgene	ERBB2	GO:0035556	intracellular signal transduction	19372587
Tgene	ERBB2	GO:0042060	wound healing	12646923
Tgene	ERBB2	GO:0043406	positive regulation of MAP kinase activity	10572067
Tgene	ERBB2	GO:0045785	positive regulation of cell adhesion	7556068
Tgene	ERBB2	GO:0046777	protein autophosphorylation	7556068
Tgene	ERBB2	GO:0050679	positive regulation of epithelial cell proliferation	10572067
Tgene	ERBB2	GO:0071363	cellular response to growth factor stimulus	20010870
Tgene	ERBB2	GO:0090314	positive regulation of protein targeting to membrane	20010870

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:48452873/chr17:37882815)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EME1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ERBB2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000393271	EME1	chr17	48452873	+	ENST00000584601	ERBB2	chr17	37882815	+	1742	529	66	1424	452
ENST00000393271	EME1	chr17	48452873	+	ENST00000406381	ERBB2	chr17	37882815	+	2043	529	66	1424	452
ENST00000393271	EME1	chr17	48452873	+	ENST00000541774	ERBB2	chr17	37882815	+	2043	529	66	1424	452
ENST00000393271	EME1	chr17	48452873	+	ENST00000445658	ERBB2	chr17	37882815	+	1460	529	66	1424	452
ENST00000393271	EME1	chr17	48452873	+	ENST00000540147	ERBB2	chr17	37882815	+	2043	529	66	1424	452
ENST00000393271	EME1	chr17	48452873	+	ENST00000584450	ERBB2	chr17	37882815	+	1172	529	66	824	252
ENST00000393271	EME1	chr17	48452873	+	ENST00000269571	ERBB2	chr17	37882815	+	2043	529	66	1424	452
ENST00000338165	EME1	chr17	48452873	+	ENST00000584601	ERBB2	chr17	37882815	+	1742	529	66	1424	452
ENST00000338165	EME1	chr17	48452873	+	ENST00000406381	ERBB2	chr17	37882815	+	2043	529	66	1424	452
ENST00000338165	EME1	chr17	48452873	+	ENST00000541774	ERBB2	chr17	37882815	+	2043	529	66	1424	452
ENST00000338165	EME1	chr17	48452873	+	ENST00000445658	ERBB2	chr17	37882815	+	1460	529	66	1424	452
ENST00000338165	EME1	chr17	48452873	+	ENST00000540147	ERBB2	chr17	37882815	+	2043	529	66	1424	452
ENST00000338165	EME1	chr17	48452873	+	ENST00000584450	ERBB2	chr17	37882815	+	1172	529	66	824	252
ENST00000338165	EME1	chr17	48452873	+	ENST00000269571	ERBB2	chr17	37882815	+	2043	529	66	1424	452
ENST00000511648	EME1	chr17	48452873	+	ENST00000584601	ERBB2	chr17	37882815	+	1684	471	8	1366	452
ENST00000511648	EME1	chr17	48452873	+	ENST00000406381	ERBB2	chr17	37882815	+	1985	471	8	1366	452
ENST00000511648	EME1	chr17	48452873	+	ENST00000541774	ERBB2	chr17	37882815	+	1985	471	8	1366	452
ENST00000511648	EME1	chr17	48452873	+	ENST00000445658	ERBB2	chr17	37882815	+	1402	471	8	1366	452
ENST00000511648	EME1	chr17	48452873	+	ENST00000540147	ERBB2	chr17	37882815	+	1985	471	8	1366	452
ENST00000511648	EME1	chr17	48452873	+	ENST00000584450	ERBB2	chr17	37882815	+	1114	471	8	766	252
ENST00000511648	EME1	chr17	48452873	+	ENST00000269571	ERBB2	chr17	37882815	+	1985	471	8	1366	452

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000393271	ENST00000584601	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.008206832	0.9917931
ENST00000393271	ENST00000406381	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005731222	0.9942688
ENST00000393271	ENST00000541774	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005731222	0.9942688
ENST00000393271	ENST00000445658	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.008419556	0.9915804
ENST00000393271	ENST00000540147	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005731222	0.9942688
ENST00000393271	ENST00000584450	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.08464549	0.9153545
ENST00000393271	ENST00000269571	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005731222	0.9942688
ENST00000338165	ENST00000584601	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.008206832	0.9917931
ENST00000338165	ENST00000406381	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005731222	0.9942688
ENST00000338165	ENST00000541774	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005731222	0.9942688
ENST00000338165	ENST00000445658	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.008419556	0.9915804
ENST00000338165	ENST00000540147	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005731222	0.9942688
ENST00000338165	ENST00000584450	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.08464549	0.9153545
ENST00000338165	ENST00000269571	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005731222	0.9942688
ENST00000511648	ENST00000584601	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.00815844	0.99184155
ENST00000511648	ENST00000406381	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005661003	0.99433905
ENST00000511648	ENST00000541774	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005661003	0.99433905
ENST00000511648	ENST00000445658	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.008179354	0.9918207
ENST00000511648	ENST00000540147	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005661003	0.99433905
ENST00000511648	ENST00000584450	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.1041308	0.89586914
ENST00000511648	ENST00000269571	EME1	chr17	48452873	+	ERBB2	chr17	37882815	+	0.005661003	0.99433905

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EME1-ERBB2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EME1	chr17	48452873	ERBB2	chr17	37882815	471	153	PEECLKHIIVVLDPGWMIDSECRPRF
EME1	chr17	48452873	ERBB2	chr17	37882815	529	153	PEECLKHIIVVLDPGWMIDSECRPRF

Top

Potential FusionNeoAntigen Information of EME1-ERBB2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EME1-ERBB2_48452873_37882815.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-B58:01	IIVVLDPGW	0.9674	0.9117	7	16
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A02:21	VVLDPGWMI	0.9492	0.691	9	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A02:35	VVLDPGWMI	0.908	0.6331	9	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A02:20	VVLDPGWMI	0.9033	0.5941	9	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A02:17	VVLDPGWMI	0.8924	0.6574	9	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A32:13	VVLDPGWMI	0.5545	0.9813	9	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C04:10	VLDPGWMI	1	0.9676	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C05:09	VLDPGWMI	0.9999	0.9958	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C04:07	VLDPGWMI	0.9999	0.9413	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C08:15	VLDPGWMI	0.9996	0.9963	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A02:07	VLDPGWMI	0.9744	0.7073	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C04:03	VLDPGWMI	1	0.9664	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C18:01	VLDPGWMI	0.9999	0.9673	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C05:01	VLDPGWMI	0.9999	0.9958	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C04:01	VLDPGWMI	0.9999	0.9413	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C08:02	VLDPGWMI	0.9996	0.9963	10	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A02:14	VVLDPGWMI	0.9501	0.6602	9	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A02:06	VVLDPGWMI	0.9492	0.691	9	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-A69:01	VVLDPGWMI	0.8081	0.761	9	18
EME1-ERBB2	chr17	48452873	chr17	37882815	529	HLA-C17:01	VVLDPGWMI	0.336	0.9779	9	18

Top

Potential FusionNeoAntigen Information of EME1-ERBB2 in HLA II

EME1-ERBB2_48452873_37882815.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EME1-ERBB2	chr17	48452873	chr17	37882815	529	DRB1-1525	HIIVVLDPGWMIDSE	6	21
EME1-ERBB2	chr17	48452873	chr17	37882815	529	DRB1-1525	KHIIVVLDPGWMIDS	5	20
EME1-ERBB2	chr17	48452873	chr17	37882815	529	DRB3-0105	HIIVVLDPGWMIDSE	6	21

Top

Fusion breakpoint peptide structures of EME1-ERBB2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3366	HIIVVLDPGWMIDS	EME1	ERBB2	chr17	48452873	chr17	37882815	529

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EME1-ERBB2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3366	HIIVVLDPGWMIDS	-7.9962	-8.1096
HLA-B14:02	3BVN	3366	HIIVVLDPGWMIDS	-5.70842	-6.74372
HLA-B52:01	3W39	3366	HIIVVLDPGWMIDS	-6.83737	-6.95077
HLA-B52:01	3W39	3366	HIIVVLDPGWMIDS	-4.4836	-5.5189
HLA-A11:01	4UQ2	3366	HIIVVLDPGWMIDS	-10.0067	-10.1201
HLA-A11:01	4UQ2	3366	HIIVVLDPGWMIDS	-9.03915	-10.0745
HLA-A24:02	5HGA	3366	HIIVVLDPGWMIDS	-6.56204	-6.67544
HLA-A24:02	5HGA	3366	HIIVVLDPGWMIDS	-5.42271	-6.45801
HLA-B44:05	3DX8	3366	HIIVVLDPGWMIDS	-7.85648	-8.89178
HLA-B44:05	3DX8	3366	HIIVVLDPGWMIDS	-5.3978	-5.5112
HLA-A02:01	6TDR	3366	HIIVVLDPGWMIDS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of EME1-ERBB2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EME1-ERBB2	chr17	48452873	chr17	37882815	10	18	VLDPGWMI	TGGATCCAGGTTGGATGATTGACT
EME1-ERBB2	chr17	48452873	chr17	37882815	7	16	IIVVLDPGW	TTGTAGTGCTGGATCCAGGTTGGATGA
EME1-ERBB2	chr17	48452873	chr17	37882815	9	18	VVLDPGWMI	TGCTGGATCCAGGTTGGATGATTGACT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
EME1-ERBB2	chr17	48452873	chr17	37882815	5	20	KHIIVVLDPGWMIDS	ACATCATTGTAGTGCTGGATCCAGGTTGGATGATTGACTCTGAAT
EME1-ERBB2	chr17	48452873	chr17	37882815	6	21	HIIVVLDPGWMIDSE	TCATTGTAGTGCTGGATCCAGGTTGGATGATTGACTCTGAATGTC

Top

Information of the samples that have these potential fusion neoantigens of EME1-ERBB2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	EME1-ERBB2	chr17	48452873	ENST00000338165	chr17	37882815	ENST00000269571	TCGA-BH-A1F2-01A

Top

Potential target of CAR-T therapy development for EME1-ERBB2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EME1-ERBB2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EME1-ERBB2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)