![]() |
|||||||
|
Fusion Protein:ENTPD6-ADRM1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ENTPD6-ADRM1 | FusionPDB ID: 26713 | FusionGDB2.0 ID: 26713 | Hgene | Tgene | Gene symbol | ENTPD6 | ADRM1 | Gene ID | 955 | 11047 |
Gene name | ectonucleoside triphosphate diphosphohydrolase 6 | adhesion regulating molecule 1 | |
Synonyms | CD39L2|IL-6SAG|IL6ST2|NTPDase-6|dJ738P15.3 | ARM-1|ARM1|GP110 | |
Cytomap | 20p11.21 | 20q13.33 | |
Type of gene | protein-coding | protein-coding | |
Description | ectonucleoside triphosphate diphosphohydrolase 6CD39 antigen-like 2NTPDase 6ectonucleoside triphosphate diphosphohydrolase 6 (putative)interleukin 6 signal transducer-2 | proteasomal ubiquitin receptor ADRM1110 kDa cell membrane glycoproteinM(r) 110,000 surface antigenproteasome regulatory particle non-ATPase 13proteasome ubiquitin receptorrpn13 homolog | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | O75354 Main function of 5'-partner protein: FUNCTION: Catalyzes the hydrolysis of nucleoside triphosphates and diphosphates in a calcium- or magnesium-dependent manner. Has a strong preference for nucleoside diphosphates, preferentially hydrolyzes GDP, IDP, and UDP, with slower hydrolysis of CDP, ITP, GTP, CTP, ADP, and UTP and virtually no hydrolysis of ATP (PubMed:10948193, PubMed:14529283, PubMed:11041856). The membrane bound form might support glycosylation reactions in the Golgi apparatus and, when released from cells, might catalyze the hydrolysis of extracellular nucleotides (PubMed:10948193, PubMed:14529283, PubMed:11041856). {ECO:0000269|PubMed:10948193, ECO:0000269|PubMed:11041856, ECO:0000269|PubMed:14529283}. | Q16186 Main function of 5'-partner protein: FUNCTION: Component of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. This complex plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins, which could impair cellular functions, and by removing proteins whose functions are no longer required. Therefore, the proteasome participates in numerous cellular processes, including cell cycle progression, apoptosis, or DNA damage repair. Within the complex, functions as a proteasomal ubiquitin receptor. Engages and activates 19S-associated deubiquitinases UCHL5 and PSMD14 during protein degradation. UCHL5 reversibly associate with the 19S regulatory particle whereas PSMD14 is an intrinsic subunit of the proteasome lid subcomplex. {ECO:0000269|PubMed:16815440, ECO:0000269|PubMed:16906146, ECO:0000269|PubMed:16990800, ECO:0000269|PubMed:17139257, ECO:0000269|PubMed:18497817, ECO:0000269|PubMed:24752541, ECO:0000269|PubMed:25702870, ECO:0000269|PubMed:25702872}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000485936, ENST00000354989, ENST00000360031, ENST00000376652, ENST00000433259, | ENST00000253003, ENST00000462554, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 8 X 7 X 4=224 | 8 X 6 X 5=240 |
# samples | 8 | 8 | |
** MAII score | log2(8/224*10)=-1.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(8/240*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ENTPD6 [Title/Abstract] AND ADRM1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ENTPD6 [Title/Abstract] AND ADRM1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ENTPD6(25205953)-ADRM1(60882426), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ENTPD6-ADRM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ENTPD6-ADRM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ENTPD6-ADRM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ENTPD6-ADRM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ENTPD6-ADRM1 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. ENTPD6-ADRM1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ADRM1 | GO:0043248 | proteasome assembly | 16990800 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:25205953/chr20:60882426) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000433259 | ENTPD6 | chr20 | 25205953 | + | ENST00000253003 | ADRM1 | chr20 | 60882426 | + | 2207 | 1423 | 126 | 2105 | 659 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000433259 | ENST00000253003 | ENTPD6 | chr20 | 25205953 | + | ADRM1 | chr20 | 60882426 | + | 0.01482279 | 0.9851773 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ENTPD6-ADRM1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ENTPD6 | chr20 | 25205953 | ADRM1 | chr20 | 60882426 | 1423 | 432 | TPGVRLSQEQSAEGGLGALTGPGLAS |
Top |
Potential FusionNeoAntigen Information of ENTPD6-ADRM1 in HLA I |
![]() |
ENTPD6-ADRM1_25205953_60882426.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B45:01 | AEGGLGALT | 0.8439 | 0.9899 | 11 | 20 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B50:02 | AEGGLGALT | 0.8207 | 0.8609 | 11 | 20 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B45:01 | QEQSAEGGLGA | 0.9962 | 0.9851 | 7 | 18 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B50:02 | QEQSAEGGLGA | 0.9938 | 0.963 | 7 | 18 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B50:01 | QEQSAEGGLGA | 0.9928 | 0.9881 | 7 | 18 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B41:01 | QEQSAEGGLGA | 0.991 | 0.9742 | 7 | 18 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B39:08 | AEGGLGAL | 0.96 | 0.9773 | 11 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C05:09 | SAEGGLGAL | 0.9997 | 0.9854 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C08:15 | SAEGGLGAL | 0.9995 | 0.9894 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C03:19 | SAEGGLGAL | 0.9943 | 0.9968 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C03:08 | SAEGGLGAL | 0.9809 | 0.9631 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C08:13 | SAEGGLGAL | 0.8843 | 0.9863 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C08:04 | SAEGGLGAL | 0.8843 | 0.9863 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C08:03 | SAEGGLGAL | 0.7057 | 0.9951 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B41:03 | AEGGLGAL | 0.8842 | 0.9523 | 11 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C05:01 | SAEGGLGAL | 0.9997 | 0.9854 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C08:02 | SAEGGLGAL | 0.9995 | 0.9894 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C03:04 | SAEGGLGAL | 0.9944 | 0.996 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C03:03 | SAEGGLGAL | 0.9944 | 0.996 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C03:05 | SAEGGLGAL | 0.9816 | 0.9546 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B40:04 | QEQSAEGGL | 0.9699 | 0.8097 | 7 | 16 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C03:06 | SAEGGLGAL | 0.8753 | 0.9964 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-C08:01 | SAEGGLGAL | 0.7057 | 0.9951 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B35:13 | SAEGGLGAL | 0.512 | 0.9102 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B41:03 | QEQSAEGGL | 0.3417 | 0.8816 | 7 | 16 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B07:13 | SAEGGLGAL | 0.2586 | 0.8004 | 10 | 19 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B50:05 | QEQSAEGGLGA | 0.9928 | 0.9881 | 7 | 18 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | HLA-B50:04 | QEQSAEGGLGA | 0.9928 | 0.9881 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of ENTPD6-ADRM1 in HLA II |
![]() |
ENTPD6-ADRM1_25205953_60882426.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | DRB1-0102 | AEGGLGALTGPGLAS | 11 | 26 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | DRB1-0413 | GVRLSQEQSAEGGLG | 2 | 17 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | DRB1-0906 | TPGVRLSQEQSAEGG | 0 | 15 |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 | DRB1-1523 | TPGVRLSQEQSAEGG | 0 | 15 |
Top |
Fusion breakpoint peptide structures of ENTPD6-ADRM1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8914 | SQEQSAEGGLGALT | ENTPD6 | ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 1423 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ENTPD6-ADRM1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8914 | SQEQSAEGGLGALT | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 8914 | SQEQSAEGGLGALT | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 8914 | SQEQSAEGGLGALT | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 8914 | SQEQSAEGGLGALT | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 8914 | SQEQSAEGGLGALT | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 8914 | SQEQSAEGGLGALT | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 8914 | SQEQSAEGGLGALT | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 8914 | SQEQSAEGGLGALT | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 8914 | SQEQSAEGGLGALT | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 8914 | SQEQSAEGGLGALT | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 8914 | SQEQSAEGGLGALT | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of ENTPD6-ADRM1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 10 | 19 | SAEGGLGAL | GTGCTGAAGGTGGGCTGGGGGCCCTGA |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 11 | 19 | AEGGLGAL | CTGAAGGTGGGCTGGGGGCCCTGA |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 11 | 20 | AEGGLGALT | CTGAAGGTGGGCTGGGGGCCCTGACTG |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 7 | 16 | QEQSAEGGL | AGGAGCAAAGTGCTGAAGGTGGGCTGG |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 7 | 18 | QEQSAEGGLGA | AGGAGCAAAGTGCTGAAGGTGGGCTGGGGGCCC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 0 | 15 | TPGVRLSQEQSAEGG | CTCCAGGAGTTCGGCTTTCCCAGGAGCAAAGTGCTGAAGGTGGGC |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 11 | 26 | AEGGLGALTGPGLAS | CTGAAGGTGGGCTGGGGGCCCTGACTGGACCTGGCCTGGCCAGCT |
ENTPD6-ADRM1 | chr20 | 25205953 | chr20 | 60882426 | 2 | 17 | GVRLSQEQSAEGGLG | GAGTTCGGCTTTCCCAGGAGCAAAGTGCTGAAGGTGGGCTGGGGG |
Top |
Information of the samples that have these potential fusion neoantigens of ENTPD6-ADRM1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
ESCA | ENTPD6-ADRM1 | chr20 | 25205953 | ENST00000433259 | chr20 | 60882426 | ENST00000253003 | TCGA-L5-A88V |
Top |
Potential target of CAR-T therapy development for ENTPD6-ADRM1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Hgene | ENTPD6 | chr20:25205953 | chr20:60882426 | ENST00000354989 | + | 13 | 14 | 40_60 | 435 | 468.0 | Transmembrane | Helical%3B Signal-anchor for type II membrane protein |
Hgene | ENTPD6 | chr20:25205953 | chr20:60882426 | ENST00000376652 | + | 14 | 15 | 40_60 | 452 | 485.0 | Transmembrane | Helical%3B Signal-anchor for type II membrane protein |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ENTPD6-ADRM1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ENTPD6-ADRM1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |