|
|||||||
|
Fusion Protein:FAT1-DHX36 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: FAT1-DHX36 | FusionPDB ID: 29453 | FusionGDB2.0 ID: 29453 | Hgene | Tgene | Gene symbol | FAT1 | DHX36 | Gene ID | 2195 | 170506 |
| Gene name | FAT atypical cadherin 1 | DEAH-box helicase 36 | |
| Synonyms | CDHF7|CDHR8|FAT|ME5|hFat1 | DDX36|G4R1|MLEL1|RHAU | |
| Cytomap | 4q35.2 | 3q25.2 | |
| Type of gene | protein-coding | protein-coding | |
| Description | protocadherin Fat 1FAT tumor suppressor 1cadherin ME5cadherin family member 7cadherin-related family member 8cadherin-related tumor suppressor homologprotein fat homolog | ATP-dependent DNA/RNA helicase DHX36ATP-dependent RNA helicase DHX36DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36DEAD/H box polypeptide 36DEAH (Asp-Glu-Ala-His) box polypeptide 36DEAH box protein 36G4 resolvase-1MLE-like protein 1RNA helicase as | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q14517 Main function of 5'-partner protein: FUNCTION: [Protocadherin Fat 1]: Plays an essential role for cellular polarization, directed cell migration and modulating cell-cell contact. {ECO:0000250}. | Q9H2U1 Main function of 5'-partner protein: FUNCTION: Multifunctional ATP-dependent helicase that unwinds G-quadruplex (G4) structures (PubMed:16150737, PubMed:18854321, PubMed:20472641, PubMed:21586581). Plays a role in many biological processes such as genomic integrity, gene expression regulations and as a sensor to initiate antiviral responses (PubMed:14731398, PubMed:18279852, PubMed:21993297, PubMed:22238380, PubMed:25579584). G4 structures correspond to helical structures containing guanine tetrads (By similarity). Binds with high affinity to and unwinds G4 structures that are formed in nucleic acids (G4-ADN and G4-RNA) (PubMed:16150737, PubMed:18842585, PubMed:20472641, PubMed:21586581, PubMed:24369427, PubMed:26195789). Plays a role in genomic integrity (PubMed:22238380). Converts the G4-RNA structure present in telomerase RNA template component (TREC) into a double-stranded RNA to promote P1 helix formation that acts as a template boundary ensuring accurate reverse transcription (PubMed:20472641, PubMed:21149580, PubMed:21846770, PubMed:22238380, PubMed:24151078, PubMed:25579584). Plays a role in transcriptional regulation (PubMed:21586581, PubMed:21993297). Resolves G4-DNA structures in promoters of genes, such as YY1, KIT/c-kit and ALPL and positively regulates their expression (PubMed:21993297). Plays a role in post-transcriptional regulation (PubMed:27940037). Unwinds a G4-RNA structure located in the 3'-UTR polyadenylation site of the pre-mRNA TP53 and stimulates TP53 pre-mRNA 3'-end processing in response to ultraviolet (UV)-induced DNA damage (PubMed:27940037). Binds to the precursor-microRNA-134 (pre-miR-134) terminal loop and regulates its transport into the synapto-dendritic compartment (By similarity). Involved in the pre-miR-134-dependent inhibition of target gene expression and the control of dendritic spine size (By similarity). Plays a role in the regulation of cytoplasmic mRNA translation and mRNA stability (PubMed:24369427, PubMed:26489465). Binds to both G4-RNA structures and alternative non-quadruplex-forming sequence within the 3'-UTR of the PITX1 mRNA regulating negatively PITX1 protein expression (PubMed:24369427). Binds to both G4-RNA structure in the 5'-UTR and AU-rich elements (AREs) localized in the 3'-UTR of NKX2-5 mRNA to either stimulate protein translation or induce mRNA decay in an ELAVL1-dependent manner, respectively (PubMed:26489465). Binds also to ARE sequences present in several mRNAs mediating exosome-mediated 3'-5' mRNA degradation (PubMed:14731398, PubMed:18279852). Involved in cytoplasmic urokinase-type plasminogen activator (uPA) mRNA decay (PubMed:14731398). Component of a multi-helicase-TICAM1 complex that acts as a cytoplasmic sensor of viral double-stranded RNA (dsRNA) and plays a role in the activation of a cascade of antiviral responses including the induction of proinflammatory cytokines via the adapter molecule TICAM1 (By similarity). Required for early embryonic development and hematopoiesis. Involved in the regulation of cardioblast differentiation and proliferation during heart development. Involved in spermatogonia differentiation. May play a role in ossification (By similarity). {ECO:0000250|UniProtKB:D4A2Z8, ECO:0000250|UniProtKB:Q05B79, ECO:0000250|UniProtKB:Q8VHK9, ECO:0000269|PubMed:14731398, ECO:0000269|PubMed:16150737, ECO:0000269|PubMed:18279852, ECO:0000269|PubMed:18842585, ECO:0000269|PubMed:18854321, ECO:0000269|PubMed:20472641, ECO:0000269|PubMed:21149580, ECO:0000269|PubMed:21586581, ECO:0000269|PubMed:21846770, ECO:0000269|PubMed:21993297, ECO:0000269|PubMed:22238380, ECO:0000269|PubMed:24151078, ECO:0000269|PubMed:24369427, ECO:0000269|PubMed:25579584, ECO:0000269|PubMed:26195789, ECO:0000269|PubMed:26489465, ECO:0000269|PubMed:27940037}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000441802, ENST00000512347, | ENST00000308361, ENST00000329463, ENST00000496811, ENST00000544526, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 16 X 17 X 8=2176 | 7 X 8 X 3=168 |
| # samples | 20 | 8 | |
| ** MAII score | log2(20/2176*10)=-3.44360665147561 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(8/168*10)=-1.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: FAT1 [Title/Abstract] AND DHX36 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: FAT1 [Title/Abstract] AND DHX36 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FAT1(187560875)-DHX36(154001060), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | FAT1-DHX36 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FAT1-DHX36 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FAT1-DHX36 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FAT1-DHX36 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | DHX36 | GO:0010501 | RNA secondary structure unwinding | 18842585|20472641|21149580|21846770|22238380 |
| Tgene | DHX36 | GO:0017148 | negative regulation of translation | 24369427 |
| Tgene | DHX36 | GO:0034605 | cellular response to heat | 18854321 |
| Tgene | DHX36 | GO:0044806 | G-quadruplex DNA unwinding | 16150737|18842585 |
| Tgene | DHX36 | GO:0090669 | telomerase RNA stabilization | 22238380 |
| Tgene | DHX36 | GO:1903843 | cellular response to arsenite ion | 18854321 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:187560875/chr3:154001060) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across FAT1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across DHX36 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000441802 | FAT1 | chr4 | 187560875 | - | ENST00000496811 | DHX36 | chr3 | 154001060 | - | 8212 | 3852 | 210 | 4586 | 1458 |
| ENST00000441802 | FAT1 | chr4 | 187560875 | - | ENST00000308361 | DHX36 | chr3 | 154001060 | - | 5090 | 3852 | 210 | 4586 | 1458 |
| ENST00000441802 | FAT1 | chr4 | 187560875 | - | ENST00000544526 | DHX36 | chr3 | 154001060 | - | 5089 | 3852 | 210 | 4586 | 1458 |
| ENST00000441802 | FAT1 | chr4 | 187560875 | - | ENST00000329463 | DHX36 | chr3 | 154001060 | - | 4587 | 3852 | 210 | 4586 | 1458 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000441802 | ENST00000496811 | FAT1 | chr4 | 187560875 | - | DHX36 | chr3 | 154001060 | - | 0.000124072 | 0.9998759 |
| ENST00000441802 | ENST00000308361 | FAT1 | chr4 | 187560875 | - | DHX36 | chr3 | 154001060 | - | 0.00023159 | 0.99976844 |
| ENST00000441802 | ENST00000544526 | FAT1 | chr4 | 187560875 | - | DHX36 | chr3 | 154001060 | - | 0.000231435 | 0.99976856 |
| ENST00000441802 | ENST00000329463 | FAT1 | chr4 | 187560875 | - | DHX36 | chr3 | 154001060 | - | 0.000336866 | 0.9996631 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FAT1-DHX36 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| FAT1 | chr4 | 187560875 | DHX36 | chr3 | 154001060 | 3852 | 1214 | KLDREQQDEHILEGWEEARRRGFRYE |
Top |
Potential FusionNeoAntigen Information of FAT1-DHX36 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| FAT1-DHX36_187560875_154001060.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B44:03 | DEHILEGW | 0.9997 | 0.9831 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B18:01 | DEHILEGW | 0.9975 | 0.945 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B39:06 | EHILEGWEEA | 0.9938 | 0.866 | 8 | 18 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-A32:13 | QQDEHILEGW | 0.7153 | 0.9847 | 5 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B13:01 | QQDEHILEGW | 0.5721 | 0.9764 | 5 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B44:08 | QQDEHILEGW | 0.984 | 0.6326 | 5 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B44:08 | EQQDEHILEGW | 0.9982 | 0.5493 | 4 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B44:26 | DEHILEGW | 0.9997 | 0.9831 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B44:07 | DEHILEGW | 0.9997 | 0.9831 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B44:13 | DEHILEGW | 0.9997 | 0.9831 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B18:08 | DEHILEGW | 0.9978 | 0.9193 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B18:05 | DEHILEGW | 0.9975 | 0.945 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B18:06 | DEHILEGW | 0.997 | 0.952 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B18:03 | DEHILEGW | 0.9961 | 0.9387 | 7 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B44:21 | QQDEHILEGW | 0.9724 | 0.504 | 5 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B15:24 | QQDEHILEGW | 0.9627 | 0.957 | 5 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B15:13 | QQDEHILEGW | 0.7648 | 0.8194 | 5 | 15 |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 | HLA-B15:13 | EQQDEHILEGW | 0.9838 | 0.8149 | 4 | 15 |
Top |
Potential FusionNeoAntigen Information of FAT1-DHX36 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of FAT1-DHX36 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 7177 | QDEHILEGWEEARR | FAT1 | DHX36 | chr4 | 187560875 | chr3 | 154001060 | 3852 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FAT1-DHX36 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 7177 | QDEHILEGWEEARR | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 7177 | QDEHILEGWEEARR | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 7177 | QDEHILEGWEEARR | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 7177 | QDEHILEGWEEARR | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 7177 | QDEHILEGWEEARR | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 7177 | QDEHILEGWEEARR | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 7177 | QDEHILEGWEEARR | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 7177 | QDEHILEGWEEARR | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 7177 | QDEHILEGWEEARR | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 7177 | QDEHILEGWEEARR | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 7177 | QDEHILEGWEEARR | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of FAT1-DHX36 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 4 | 15 | EQQDEHILEGW | GAACAGCAAGATGAACACATATTAGAGGGCTGG |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 5 | 15 | QQDEHILEGW | CAGCAAGATGAACACATATTAGAGGGCTGG |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 7 | 15 | DEHILEGW | GATGAACACATATTAGAGGGCTGG |
| FAT1-DHX36 | chr4 | 187560875 | chr3 | 154001060 | 8 | 18 | EHILEGWEEA | GAACACATATTAGAGGGCTGGGAAGAGGCT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of FAT1-DHX36 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | FAT1-DHX36 | chr4 | 187560875 | ENST00000441802 | chr3 | 154001060 | ENST00000308361 | TCGA-CG-4301 |
Top |
Potential target of CAR-T therapy development for FAT1-DHX36 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
| FAT1 | chr4 | 187560875 | ENST00000441802 | DHX36 | chr3 | 154001060 | ENST00000308361 |  |
Top |
Related Drugs to FAT1-DHX36 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FAT1-DHX36 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies