|
|||||||
|
Fusion Protein:AGRN-MXI1 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: AGRN-MXI1 | FusionPDB ID: 3001 | FusionGDB2.0 ID: 3001 | Hgene | Tgene | Gene symbol | AGRN | MXI1 | Gene ID | 375790 | 4601 |
| Gene name | agrin | MAX interactor 1, dimerization protein | |
| Synonyms | AGRIN|CMS8|CMSPPD | MAD2|MXD2|MXI|bHLHc11 | |
| Cytomap | 1p36.33 | 10q25.2 | |
| Type of gene | protein-coding | protein-coding | |
| Description | agrinagrin proteoglycan | max-interacting protein 1MAX dimerization protein 2Max-related transcription factorclass C basic helix-loop-helix protein 11 | |
| Modification date | 20200315 | 20200313 | |
| UniProtAcc | O00468 Main function of 5'-partner protein: FUNCTION: [Isoform 1]: heparan sulfate basal lamina glycoprotein that plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ) and directs key events in postsynaptic differentiation. Component of the AGRN-LRP4 receptor complex that induces the phosphorylation and activation of MUSK. The activation of MUSK in myotubes induces the formation of NMJ by regulating different processes including the transcription of specific genes and the clustering of AChR in the postsynaptic membrane. Calcium ions are required for maximal AChR clustering. AGRN function in neurons is highly regulated by alternative splicing, glycan binding and proteolytic processing. Modulates calcium ion homeostasis in neurons, specifically by inducing an increase in cytoplasmic calcium ions. Functions differentially in the central nervous system (CNS) by inhibiting the alpha(3)-subtype of Na+/K+-ATPase and evoking depolarization at CNS synapses. This secreted isoform forms a bridge, after release from motor neurons, to basal lamina through binding laminin via the NtA domain.; FUNCTION: [Isoform 2]: transmembrane form that is the predominate form in neurons of the brain, induces dendritic filopodia and synapse formation in mature hippocampal neurons in large part due to the attached glycosaminoglycan chains and the action of Rho-family GTPases.; FUNCTION: Isoform 1, isoform 4 and isoform 5: neuron-specific (z+) isoforms that contain C-terminal insertions of 8-19 AA are potent activators of AChR clustering. Isoform 5, agrin (z+8), containing the 8-AA insert, forms a receptor complex in myotubules containing the neuronal AGRN, the muscle-specific kinase MUSK and LRP4, a member of the LDL receptor family. The splicing factors, NOVA1 and NOVA2, regulate AGRN splicing and production of the 'z' isoforms.; FUNCTION: Isoform 3 and isoform 6: lack any 'z' insert, are muscle-specific and may be involved in endothelial cell differentiation.; FUNCTION: [Agrin N-terminal 110 kDa subunit]: is involved in regulation of neurite outgrowth probably due to the presence of the glycosaminoglcan (GAG) side chains of heparan and chondroitin sulfate attached to the Ser/Thr- and Gly/Ser-rich regions. Also involved in modulation of growth factor signaling (By similarity). {ECO:0000250, ECO:0000269|PubMed:19631309, ECO:0000269|PubMed:21969364}.; FUNCTION: [Agrin C-terminal 22 kDa fragment]: this released fragment is important for agrin signaling and to exert a maximal dendritic filopodia-inducing effect. All 'z' splice variants (z+) of this fragment also show an increase in the number of filopodia. | P50539 Main function of 5'-partner protein: FUNCTION: Transcriptional repressor. MXI1 binds with MAX to form a sequence-specific DNA-binding protein complex which recognizes the core sequence 5'-CAC[GA]TG-3'. MXI1 thus antagonizes MYC transcriptional activity by competing for MAX. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000477585, ENST00000379370, | ENST00000332674, ENST00000485566, ENST00000239007, ENST00000361248, ENST00000369612, ENST00000393134, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 14 X 7 X 10=980 | 17 X 10 X 9=1530 |
| # samples | 18 | 19 | |
| ** MAII score | log2(18/980*10)=-2.4447848426729 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(19/1530*10)=-3.00946032924907 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: AGRN [Title/Abstract] AND MXI1 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: AGRN [Title/Abstract] AND MXI1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | AGRN(970704)-MXI1(111987946), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | AGRN-MXI1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AGRN-MXI1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AGRN-MXI1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AGRN-MXI1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | AGRN | GO:0043113 | receptor clustering | 15340048 |
| Tgene | MXI1 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 11875718 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:970704/chr10:111987946) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across AGRN (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across MXI1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000379370 | AGRN | chr1 | 970704 | + | ENST00000332674 | MXI1 | chr10 | 111987946 | + | 3553 | 561 | 50 | 1174 | 374 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000379370 | ENST00000332674 | AGRN | chr1 | 970704 | + | MXI1 | chr10 | 111987946 | + | 0.001221085 | 0.9987789 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for AGRN-MXI1 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| AGRN | chr1 | 970704 | MXI1 | chr10 | 111987946 | 561 | 170 | GTHFTPVPPTPPDECEHGYASSFPSM |
Top |
Potential FusionNeoAntigen Information of AGRN-MXI1 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| AGRN-MXI1_970704_111987946.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B35:08 | PPDECEHGY | 0.7514 | 0.6562 | 10 | 19 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B35:01 | TPPDECEHGY | 0.9213 | 0.8148 | 9 | 19 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B35:08 | TPPDECEHGY | 0.9191 | 0.8058 | 9 | 19 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B18:01 | DECEHGYASSF | 0.9988 | 0.9145 | 12 | 23 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B35:77 | TPPDECEHGY | 0.9213 | 0.8148 | 9 | 19 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B35:23 | TPPDECEHGY | 0.9152 | 0.8223 | 9 | 19 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B18:04 | DECEHGYASSF | 0.9991 | 0.9242 | 12 | 23 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B18:08 | DECEHGYASSF | 0.9991 | 0.8167 | 12 | 23 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B18:06 | DECEHGYASSF | 0.9989 | 0.9247 | 12 | 23 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B18:05 | DECEHGYASSF | 0.9988 | 0.9145 | 12 | 23 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B18:03 | DECEHGYASSF | 0.9979 | 0.909 | 12 | 23 |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 | HLA-B18:11 | DECEHGYASSF | 0.9968 | 0.8504 | 12 | 23 |
Top |
Potential FusionNeoAntigen Information of AGRN-MXI1 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of AGRN-MXI1 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 10188 | VPPTPPDECEHGYA | AGRN | MXI1 | chr1 | 970704 | chr10 | 111987946 | 561 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AGRN-MXI1 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 10188 | VPPTPPDECEHGYA | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 10188 | VPPTPPDECEHGYA | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 10188 | VPPTPPDECEHGYA | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 10188 | VPPTPPDECEHGYA | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 10188 | VPPTPPDECEHGYA | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 10188 | VPPTPPDECEHGYA | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 10188 | VPPTPPDECEHGYA | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 10188 | VPPTPPDECEHGYA | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 10188 | VPPTPPDECEHGYA | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 10188 | VPPTPPDECEHGYA | -5.3978 | -5.5112 |
| HLA-B35:01 | 1A1N | 10188 | VPPTPPDECEHGYA | -6.27422 | -6.38762 |
| HLA-B35:01 | 1A1N | 10188 | VPPTPPDECEHGYA | -5.27424 | -6.30954 |
| HLA-A02:01 | 6TDR | 10188 | VPPTPPDECEHGYA | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of AGRN-MXI1 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 10 | 19 | PPDECEHGY | CTCCTGATGAGTGTGAACATGGCTACG |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 12 | 23 | DECEHGYASSF | ATGAGTGTGAACATGGCTACGCCTCTTCATTCC |
| AGRN-MXI1 | chr1 | 970704 | chr10 | 111987946 | 9 | 19 | TPPDECEHGY | CGCCTCCTGATGAGTGTGAACATGGCTACG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of AGRN-MXI1 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | AGRN-MXI1 | chr1 | 970704 | ENST00000379370 | chr10 | 111987946 | ENST00000332674 | TCGA-FP-8631 |
Top |
Potential target of CAR-T therapy development for AGRN-MXI1 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to AGRN-MXI1 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to AGRN-MXI1 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies