Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:FILIP1-KCNQ5

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: FILIP1-KCNQ5
	FusionPDB ID: 30418
	FusionGDB2.0 ID: 30418
		Hgene	Tgene
	Gene symbol	FILIP1	KCNQ5
	Gene ID	27145	56479
	Gene name	filamin A interacting protein 1	potassium voltage-gated channel subfamily Q member 5
	Synonyms	FILIP	Kv7.5\|MRD46
	Cytomap	6q14.1	6q13
	Type of gene	protein-coding	protein-coding
	Description	filamin-A-interacting protein 1	potassium voltage-gated channel subfamily KQT member 5KQT-like 5potassium channel proteinpotassium channel subunit alpha KvLQT5potassium channel, voltage gated KQT-like subfamily Q, member 5voltage-gated potassium channel subunit Kv7.5
	Modification date	20200320	20200313
	UniProtAcc	Q4L180 Main function of 5'-partner protein: FUNCTION: Acts as a regulator of the antiangiogenic activity on endothelial cells. When overexpressed in endothelial cells, leads to inhibition of cell proliferation and migration and an increase in apoptosis. Inhibits melanoma growth When expressed in tumor-associated vasculature. {ECO:0000269\|PubMed:18794120}.	Q9NR82 Main function of 5'-partner protein: FUNCTION: Associates with KCNQ3 to form a potassium channel which contributes to M-type current, a slowly activating and deactivating potassium conductance which plays a critical role in determining the subthreshold electrical excitability of neurons. Therefore, it is important in the regulation of neuronal excitability. May contribute, with other potassium channels, to the molecular diversity of a heterogeneous population of M-channels, varying in kinetic and pharmacological properties, which underlie this physiologically important current. Insensitive to tetraethylammonium, but inhibited by barium, linopirdine and XE991. Activated by niflumic acid and the anticonvulsant retigabine. As the native M-channel, the potassium channel composed of KCNQ3 and KCNQ5 is also suppressed by activation of the muscarinic acetylcholine receptor CHRM1. {ECO:0000269\|PubMed:10787416, ECO:0000269\|PubMed:11159685, ECO:0000269\|PubMed:28669405}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000237172, ENST00000393004, ENST00000370020, ENST00000498523,	ENST00000342056, ENST00000355194, ENST00000355635, ENST00000370392, ENST00000370398, ENST00000402622, ENST00000403813, ENST00000414165,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 4 X 3=48	6 X 6 X 3=108
	# samples	4	6
	** MAII score	log2(4/48*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/108*10)=-0.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: FILIP1 [Title/Abstract] AND KCNQ5 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: FILIP1 [Title/Abstract] AND KCNQ5 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	FILIP1(76124413)-KCNQ5(73814980), # samples:1
Anticipated loss of major functional domain due to fusion event.	FILIP1-KCNQ5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FILIP1-KCNQ5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	KCNQ5	GO:0071805	potassium ion transmembrane transport	10787416\|11159685

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:76124413/chr6:73814980)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across FILIP1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across KCNQ5 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000393004	FILIP1	chr6	76124413	-	ENST00000342056	KCNQ5	chr6	73814980	+	5870	498	222	2435	737
ENST00000393004	FILIP1	chr6	76124413	-	ENST00000355194	KCNQ5	chr6	73814980	+	5799	498	222	2378	718
ENST00000393004	FILIP1	chr6	76124413	-	ENST00000370398	KCNQ5	chr6	73814980	+	5816	498	222	2378	718
ENST00000393004	FILIP1	chr6	76124413	-	ENST00000370392	KCNQ5	chr6	73814980	+	965	498	222	863	213
ENST00000393004	FILIP1	chr6	76124413	-	ENST00000355635	KCNQ5	chr6	73814980	+	2382	498	222	2381	719
ENST00000393004	FILIP1	chr6	76124413	-	ENST00000414165	KCNQ5	chr6	73814980	+	2049	498	222	2048	608
ENST00000393004	FILIP1	chr6	76124413	-	ENST00000402622	KCNQ5	chr6	73814980	+	2409	498	222	2408	728
ENST00000393004	FILIP1	chr6	76124413	-	ENST00000403813	KCNQ5	chr6	73814980	+	2352	498	222	2351	709
ENST00000237172	FILIP1	chr6	76124413	-	ENST00000342056	KCNQ5	chr6	73814980	+	5979	607	331	2544	737
ENST00000237172	FILIP1	chr6	76124413	-	ENST00000355194	KCNQ5	chr6	73814980	+	5908	607	331	2487	718
ENST00000237172	FILIP1	chr6	76124413	-	ENST00000370398	KCNQ5	chr6	73814980	+	5925	607	331	2487	718
ENST00000237172	FILIP1	chr6	76124413	-	ENST00000370392	KCNQ5	chr6	73814980	+	1074	607	331	972	213
ENST00000237172	FILIP1	chr6	76124413	-	ENST00000355635	KCNQ5	chr6	73814980	+	2491	607	331	2490	720
ENST00000237172	FILIP1	chr6	76124413	-	ENST00000414165	KCNQ5	chr6	73814980	+	2158	607	331	2157	609
ENST00000237172	FILIP1	chr6	76124413	-	ENST00000402622	KCNQ5	chr6	73814980	+	2518	607	331	2517	729
ENST00000237172	FILIP1	chr6	76124413	-	ENST00000403813	KCNQ5	chr6	73814980	+	2461	607	331	2460	710

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000393004	ENST00000342056	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.003119799	0.9968802
ENST00000393004	ENST00000355194	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.002596711	0.9974032
ENST00000393004	ENST00000370398	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.002541909	0.99745816
ENST00000393004	ENST00000370392	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.021487921	0.9785121
ENST00000393004	ENST00000355635	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.011214123	0.98878586
ENST00000393004	ENST00000414165	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.00853875	0.9914613
ENST00000393004	ENST00000402622	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.011710679	0.98828936
ENST00000393004	ENST00000403813	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.011098061	0.988902
ENST00000237172	ENST00000342056	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.003148864	0.99685115
ENST00000237172	ENST00000355194	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.002637469	0.99736255
ENST00000237172	ENST00000370398	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.002569479	0.9974305
ENST00000237172	ENST00000370392	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.016869608	0.98313034
ENST00000237172	ENST00000355635	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.010941481	0.98905855
ENST00000237172	ENST00000414165	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.008273205	0.99172676
ENST00000237172	ENST00000402622	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.01147429	0.9885257
ENST00000237172	ENST00000403813	FILIP1	chr6	76124413	-	KCNQ5	chr6	73814980	+	0.010857136	0.98914284

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for FILIP1-KCNQ5

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
FILIP1	chr6	76124413	KCNQ5	chr6	73814980	498	92	LIQLLSIMEGELQITLTTIGYGDKTP
FILIP1	chr6	76124413	KCNQ5	chr6	73814980	607	92	LIQLLSIMEGELQITLTTIGYGDKTP

Top

Potential FusionNeoAntigen Information of FILIP1-KCNQ5 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

FILIP1-KCNQ5_76124413_73814980.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B13:02	LQITLTTI	0.9851	0.6994	11	19
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B52:01	LQITLTTI	0.937	0.9587	11	19
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B13:01	MEGELQITL	0.9987	0.8846	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B50:02	MEGELQITL	0.9937	0.5594	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B44:03	MEGELQITL	0.9907	0.9293	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B45:01	GELQITLTT	0.9874	0.972	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:38	SIMEGELQI	0.9873	0.5177	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B50:02	GELQITLTT	0.9859	0.8075	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:21	SIMEGELQI	0.9815	0.6975	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:60	SIMEGELQI	0.9794	0.6021	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:67	SIMEGELQI	0.9792	0.5802	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:30	SIMEGELQI	0.9792	0.5802	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:24	SIMEGELQI	0.9792	0.5802	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:11	SIMEGELQI	0.978	0.6021	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B45:01	MEGELQITL	0.974	0.831	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:35	SIMEGELQI	0.9723	0.6223	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:29	SIMEGELQI	0.9693	0.5883	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:04	SIMEGELQI	0.9684	0.591	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:20	SIMEGELQI	0.9597	0.5862	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B18:01	MEGELQITL	0.9519	0.9193	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:13	SIMEGELQI	0.9516	0.612	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B47:01	MEGELQITL	0.9504	0.5247	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:02	QITLTTIGY	0.9145	0.8844	12	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:01	MEGELQITL	0.7137	0.9658	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:13	MEGELQITL	0.7099	0.9728	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B38:01	MEGELQITL	0.6772	0.9777	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B38:02	MEGELQITL	0.6672	0.9834	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B50:01	MEGELQITL	0.5091	0.7341	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B41:01	MEGELQITL	0.4896	0.9804	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B41:01	GELQITLTT	0.4011	0.9799	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B13:02	SIMEGELQI	0.2737	0.5231	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B13:01	SIMEGELQI	0.2264	0.9491	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B50:01	GELQITLTT	0.1584	0.8306	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:01	LQITLTTIGY	0.9995	0.6626	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:25	LQITLTTIGY	0.9887	0.8226	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:27	SIMEGELQITL	0.9981	0.6185	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:60	SIMEGELQITL	0.9972	0.6433	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:24	SIMEGELQITL	0.9971	0.6327	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:67	SIMEGELQITL	0.9971	0.6327	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:30	SIMEGELQITL	0.9971	0.6327	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:04	SIMEGELQITL	0.9969	0.5825	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:21	SIMEGELQITL	0.9968	0.7397	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:38	SIMEGELQITL	0.9968	0.6226	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:29	SIMEGELQITL	0.9958	0.636	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:20	SIMEGELQITL	0.9943	0.6374	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:35	SIMEGELQITL	0.9942	0.665	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:27	LLSIMEGELQI	0.9673	0.5061	3	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B51:07	LQITLTTI	0.9213	0.8514	11	19
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B40:06	MEGELQITL	0.9997	0.5337	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-C15:06	SIMEGELQI	0.998	0.9348	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-C04:06	SIMEGELQI	0.9958	0.9134	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B40:06	GELQITLTT	0.9828	0.755	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:07	SIMEGELQI	0.9813	0.6025	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:01	SIMEGELQI	0.9792	0.5802	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B40:03	GELQITLTT	0.8512	0.5127	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:31	QITLTTIGY	0.8187	0.7874	12	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:09	MEGELQITL	0.773	0.7816	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-C02:06	SIMEGELQI	0.7641	0.969	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:08	MEGELQITL	0.7547	0.9203	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:05	MEGELQITL	0.6691	0.9569	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:12	MEGELQITL	0.645	0.9689	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B51:07	MEGELQITL	0.062	0.8465	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:07	LQITLTTIGY	0.998	0.5255	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:05	LQITLTTIGY	0.9567	0.7849	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:04	LQITLTTIGY	0.9561	0.6756	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:01	SIMEGELQITL	0.9971	0.6327	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B40:04	MEGELQITL	0.9997	0.6662	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-C15:05	SIMEGELQI	0.9983	0.916	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-C15:02	SIMEGELQI	0.9982	0.9049	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B44:07	MEGELQITL	0.9907	0.9293	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B44:13	MEGELQITL	0.9907	0.9293	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B44:26	MEGELQITL	0.9907	0.9293	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:14	SIMEGELQI	0.9819	0.606	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:06	SIMEGELQI	0.9815	0.6975	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-C03:06	SIMEGELQI	0.9737	0.9934	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B18:07	MEGELQITL	0.9611	0.894	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B18:04	MEGELQITL	0.9593	0.931	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:03	SIMEGELQI	0.9586	0.6779	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B18:08	MEGELQITL	0.9558	0.9129	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B18:05	MEGELQITL	0.9519	0.9193	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B18:06	MEGELQITL	0.9399	0.9258	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B18:03	MEGELQITL	0.9317	0.9135	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B40:04	GELQITLTT	0.9111	0.7886	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A69:01	SIMEGELQI	0.8674	0.8068	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B18:11	MEGELQITL	0.8066	0.934	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:11	MEGELQITL	0.7539	0.8878	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:31	MEGELQITL	0.7419	0.9648	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B39:02	MEGELQITL	0.7304	0.974	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B41:03	MEGELQITL	0.6989	0.758	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B38:05	MEGELQITL	0.6772	0.9777	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B35:13	MEGELQITL	0.5771	0.9181	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-C17:01	SIMEGELQI	0.5186	0.8523	5	14
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B48:02	MEGELQITL	0.5113	0.9281	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B50:05	MEGELQITL	0.5091	0.7341	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B50:04	MEGELQITL	0.5091	0.7341	7	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B50:05	GELQITLTT	0.1584	0.8306	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B50:04	GELQITLTT	0.1584	0.8306	9	18
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:34	LQITLTTIGY	0.9995	0.6626	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:125	LQITLTTIGY	0.9995	0.6626	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:27	LQITLTTIGY	0.9995	0.6718	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:33	LQITLTTIGY	0.9995	0.6626	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:135	LQITLTTIGY	0.9993	0.6675	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:50	LQITLTTIGY	0.9992	0.8614	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:35	LQITLTTIGY	0.9977	0.6422	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:53	LQITLTTIGY	0.9974	0.6513	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:12	LQITLTTIGY	0.9953	0.6791	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:39	LQITLTTIGY	0.9882	0.6088	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:54	LQITLTTIGY	0.9827	0.6292	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B15:20	LQITLTTIGY	0.9583	0.8386	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B35:28	LQITLTTIGY	0.9482	0.84	11	21
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:14	SIMEGELQITL	0.997	0.6293	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-A02:06	SIMEGELQITL	0.9968	0.7397	5	16
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	607	HLA-B40:04	SIMEGELQITL	0.8901	0.7035	5	16

Top

Potential FusionNeoAntigen Information of FILIP1-KCNQ5 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of FILIP1-KCNQ5

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3829	IMEGELQITLTTIG	FILIP1	KCNQ5	chr6	76124413	chr6	73814980	607

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FILIP1-KCNQ5

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3829	IMEGELQITLTTIG	-7.9962	-8.1096
HLA-B14:02	3BVN	3829	IMEGELQITLTTIG	-5.70842	-6.74372
HLA-B52:01	3W39	3829	IMEGELQITLTTIG	-6.83737	-6.95077
HLA-B52:01	3W39	3829	IMEGELQITLTTIG	-4.4836	-5.5189
HLA-A11:01	4UQ2	3829	IMEGELQITLTTIG	-10.0067	-10.1201
HLA-A11:01	4UQ2	3829	IMEGELQITLTTIG	-9.03915	-10.0745
HLA-A24:02	5HGA	3829	IMEGELQITLTTIG	-6.56204	-6.67544
HLA-A24:02	5HGA	3829	IMEGELQITLTTIG	-5.42271	-6.45801
HLA-B44:05	3DX8	3829	IMEGELQITLTTIG	-7.85648	-8.89178
HLA-B44:05	3DX8	3829	IMEGELQITLTTIG	-5.3978	-5.5112
HLA-A02:01	6TDR	3829	IMEGELQITLTTIG	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of FILIP1-KCNQ5

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	11	19	LQITLTTI	TTGCAGATTACATTGACAACTATT
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	11	21	LQITLTTIGY	TTGCAGATTACATTGACAACTATTGGCTAT
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	12	21	QITLTTIGY	CAGATTACATTGACAACTATTGGCTAT
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	3	14	LLSIMEGELQI	CTACTCAGTATAATGGAAGGGGAGTTGCAGATT
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	5	14	SIMEGELQI	AGTATAATGGAAGGGGAGTTGCAGATT
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	5	16	SIMEGELQITL	AGTATAATGGAAGGGGAGTTGCAGATTACATTG
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	7	16	MEGELQITL	ATGGAAGGGGAGTTGCAGATTACATTG
FILIP1-KCNQ5	chr6	76124413	chr6	73814980	9	18	GELQITLTT	GGGGAGTTGCAGATTACATTGACAACT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of FILIP1-KCNQ5

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
UVM	FILIP1-KCNQ5	chr6	76124413	ENST00000237172	chr6	73814980	ENST00000342056	TCGA-VD-A8KJ-01A

Top

Potential target of CAR-T therapy development for FILIP1-KCNQ5

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

KCNQ5

chr6:76124413

chr6:73814980

ENST00000370392

326_346

428.0

Transmembrane

Helical%3B Name%3DSegment S6

Tgene

KCNQ5

chr6:76124413

chr6:73814980

ENST00000370398

326_346

933.0

Transmembrane

Helical%3B Name%3DSegment S6

Tgene

KCNQ5

chr6:76124413

chr6:73814980

ENST00000402622

326_346

943.0

Transmembrane

Helical%3B Name%3DSegment S6

Tgene

KCNQ5

chr6:76124413

chr6:73814980

ENST00000403813

326_346

924.0

Transmembrane

Helical%3B Name%3DSegment S6

Tgene

KCNQ5

chr6:76124413

chr6:73814980

ENST00000414165

326_346

823.0

Transmembrane

Helical%3B Name%3DSegment S6

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to FILIP1-KCNQ5

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to FILIP1-KCNQ5

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)