Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:FNDC3A-RB1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: FNDC3A-RB1
	FusionPDB ID: 30903
	FusionGDB2.0 ID: 30903
		Hgene	Tgene
	Gene symbol	FNDC3A	RB1
	Gene ID	22862	5925
	Gene name	fibronectin type III domain containing 3A	RB transcriptional corepressor 1
	Synonyms	FNDC3\|HUGO\|bA203I16.1\|bA203I16.5	OSRC\|PPP1R130\|RB\|p105-Rb\|p110-RB1\|pRb\|pp110
	Cytomap	13q14.2	13q14.2
	Type of gene	protein-coding	protein-coding
	Description	fibronectin type-III domain-containing protein 3Ahuman gene expressed in odontoblasts	retinoblastoma-associated proteinGOS563 exon 17 substitution mutation causes premature stopexon 17 tumor GOS561 substitution mutation causes premature stopprepro-retinoblastoma-associated proteinprotein phosphatase 1, regulatory subunit 130retinoblas
	Modification date	20200313	20200329
	UniProtAcc	Q9Y2H6 Main function of 5'-partner protein: FUNCTION: Mediates spermatid-Sertoli adhesion during spermatogenesis. {ECO:0000250}.	RB1CC1 Main function of 5'-partner protein: 1594
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000398316, ENST00000492622, ENST00000541916,	ENST00000484879, ENST00000267163,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	15 X 12 X 7=1260	13 X 16 X 11=2288
	# samples	16	27
	** MAII score	log2(16/1260*10)=-2.97727992349992 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(27/2288*10)=-3.08305573972756 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: FNDC3A [Title/Abstract] AND RB1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: FNDC3A [Title/Abstract] AND RB1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	FNDC3A(49688867)-RB1(49037867), # samples:2 RB1(48942740)-FNDC3A(49742748), # samples:1
Anticipated loss of major functional domain due to fusion event.	FNDC3A-RB1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FNDC3A-RB1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FNDC3A-RB1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FNDC3A-RB1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RB1-FNDC3A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RB1-FNDC3A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	RB1	GO:0043550	regulation of lipid kinase activity	16286473
Tgene	RB1	GO:0045892	negative regulation of transcription, DNA-templated	10783144\|12065415\|19223331
Tgene	RB1	GO:2000679	positive regulation of transcription regulatory region DNA binding	25100735

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr13:49688867/chr13:49037867)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across FNDC3A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RB1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000492622	FNDC3A	chr13	49688867	+	ENST00000267163	RB1	chr13	49037867	+	3153	557	299	1237	312
ENST00000541916	FNDC3A	chr13	49688867	+	ENST00000267163	RB1	chr13	49037867	+	2921	325	67	1005	312
ENST00000398316	FNDC3A	chr13	49688867	+	ENST00000267163	RB1	chr13	49037867	+	2767	171	45	851	268
ENST00000492622	FNDC3A	chr13	49688867	+	ENST00000267163	RB1	chr13	49039134	+	3048	557	299	1132	277
ENST00000541916	FNDC3A	chr13	49688867	+	ENST00000267163	RB1	chr13	49039134	+	2816	325	67	900	277
ENST00000398316	FNDC3A	chr13	49688867	+	ENST00000267163	RB1	chr13	49039134	+	2662	171	45	746	233

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000492622	ENST00000267163	FNDC3A	chr13	49688867	+	RB1	chr13	49037867	+	0.00011638	0.99988365
ENST00000541916	ENST00000267163	FNDC3A	chr13	49688867	+	RB1	chr13	49037867	+	8.05E-05	0.99991953
ENST00000398316	ENST00000267163	FNDC3A	chr13	49688867	+	RB1	chr13	49037867	+	0.000376789	0.9996232
ENST00000492622	ENST00000267163	FNDC3A	chr13	49688867	+	RB1	chr13	49039134	+	0.000109067	0.9998909
ENST00000541916	ENST00000267163	FNDC3A	chr13	49688867	+	RB1	chr13	49039134	+	9.00E-05	0.99991
ENST00000398316	ENST00000267163	FNDC3A	chr13	49688867	+	RB1	chr13	49039134	+	0.000720267	0.9992798

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for FNDC3A-RB1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
FNDC3A	chr13	49688867	RB1	chr13	49037867	171	42	VPPIYVPPGYAPQIMMCSMYGICKVK
FNDC3A	chr13	49688867	RB1	chr13	49037867	325	86	VPPIYVPPGYAPQIMMCSMYGICKVK
FNDC3A	chr13	49688867	RB1	chr13	49037867	557	86	VPPIYVPPGYAPQIMMCSMYGICKVK
FNDC3A	chr13	49688867	RB1	chr13	49039134	171	40	GSVPPIYVPPGYAPQTFKRVLIKEEE
FNDC3A	chr13	49688867	RB1	chr13	49039134	325	84	GSVPPIYVPPGYAPQTFKRVLIKEEE
FNDC3A	chr13	49688867	RB1	chr13	49039134	557	84	GSVPPIYVPPGYAPQTFKRVLIKEEE

Top

Potential FusionNeoAntigen Information of FNDC3A-RB1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

FNDC3A-RB1_49688867_49037867.msa
FNDC3A-RB1_49688867_49039134.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B35:02	VPPGYAPQI	0.7075	0.8338	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B35:04	VPPGYAPQI	0.7075	0.8338	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B82:01	APQIMMCSM	0.214	0.6759	10	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B81:01	VPPGYAPQI	0.1746	0.64	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B82:01	VPPGYAPQI	0.0862	0.6754	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:23	IYVPPGYAPQI	0.9997	0.6784	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:15	IYVPPGYAPQI	0.9997	0.9332	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:25	IYVPPGYAPQI	0.9997	0.9311	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:31	IYVPPGYAPQI	0.9996	0.8948	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:20	IYVPPGYAPQI	0.9996	0.9299	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A23:05	IYVPPGYAPQI	0.9976	0.6841	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:10	IYVPPGYAPQI	0.9946	0.6239	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A23:04	IYVPPGYAPQI	0.9835	0.5991	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:14	IYVPPGYAPQI	0.9603	0.7668	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B81:01	VPPGYAPQIMM	0.8687	0.812	5	16
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B78:01	VPPGYAPQI	0.9887	0.5077	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B51:07	VPPGYAPQI	0.9886	0.9264	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B07:12	APQIMMCSM	0.8468	0.5618	10	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B35:12	VPPGYAPQI	0.7075	0.8338	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B42:02	APQIMMCSM	0.4123	0.9042	10	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B42:01	APQIMMCSM	0.3343	0.8977	10	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B42:02	VPPGYAPQI	0.2989	0.7696	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B42:01	VPPGYAPQI	0.2313	0.7631	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:30	VPPGYAPQI	0.2236	0.9781	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B39:10	VPPGYAPQI	0.1022	0.9392	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:17	VPPGYAPQI	0.0169	0.9749	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:17	YAPQIMMCSM	0.9398	0.961	9	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:30	YAPQIMMCSM	0.8988	0.9535	9	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:17	YVPPGYAPQI	0.8805	0.9681	4	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:30	YVPPGYAPQI	0.795	0.9766	4	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:02	IYVPPGYAPQI	0.9996	0.9299	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:17	YVPPGYAPQIM	0.9984	0.9742	4	15
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A23:01	IYVPPGYAPQI	0.9968	0.6894	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:30	YVPPGYAPQIM	0.9843	0.9741	4	15
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B56:04	VPPGYAPQIMM	0.7543	0.6947	5	16
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C14:03	GYAPQIMM	0.8816	0.9864	8	16
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C14:02	GYAPQIMM	0.8816	0.9864	8	16
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B78:02	VPPGYAPQI	0.9909	0.6345	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B51:13	VPPGYAPQI	0.9882	0.5107	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B35:22	VPPGYAPQI	0.9384	0.5051	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B35:09	VPPGYAPQI	0.7075	0.8338	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B55:04	VPPGYAPQI	0.5684	0.6062	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B59:01	VPPGYAPQI	0.5602	0.5045	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B67:01	APQIMMCSM	0.5095	0.8512	10	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B82:02	APQIMMCSM	0.214	0.6759	10	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B67:01	VPPGYAPQI	0.1683	0.8835	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B82:02	VPPGYAPQI	0.0862	0.6754	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:02	VPPGYAPQI	0.0076	0.975	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:03	VPPGYAPQI	0.0068	0.9822	5	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:02	YAPQIMMCSM	0.9483	0.9575	9	19
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:03	YVPPGYAPQI	0.9225	0.9745	4	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:02	YVPPGYAPQI	0.8983	0.9677	4	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B51:29	YVPPGYAPQI	0.7628	0.5179	4	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B51:13	YVPPGYAPQI	0.5913	0.6578	4	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-A24:03	IYVPPGYAPQI	0.9997	0.6784	3	14
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:02	YVPPGYAPQIM	0.9984	0.9741	4	15
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-C01:03	YVPPGYAPQIM	0.9978	0.9805	4	15
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B07:26	VPPGYAPQIMM	0.9507	0.5338	5	16
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B55:04	VPPGYAPQIMM	0.8873	0.7446	5	16
FNDC3A-RB1	chr13	49688867	chr13	49037867	171	HLA-B56:02	VPPGYAPQIMM	0.7543	0.6947	5	16
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B07:10	APQTFKRVL	0.999	0.5351	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A31:02	GYAPQTFKR	0.9379	0.8057	10	19
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B52:01	YAPQTFKRV	0.9197	0.8473	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B08:09	APQTFKRVL	0.8603	0.62	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A31:06	GYAPQTFKR	0.8501	0.5442	10	19
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B35:08	VPPGYAPQTF	0.9251	0.5155	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B82:01	VPPGYAPQTF	0.6761	0.5785	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:25	YVPPGYAPQTF	0.9992	0.7736	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:20	YVPPGYAPQTF	0.9991	0.7705	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:15	YVPPGYAPQTF	0.999	0.7817	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:31	YVPPGYAPQTF	0.9988	0.7197	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:23	YVPPGYAPQTF	0.9983	0.6544	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:10	YVPPGYAPQTF	0.9979	0.6123	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B35:08	YVPPGYAPQTF	0.9973	0.5201	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:17	YVPPGYAPQTF	0.9967	0.7324	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B35:01	YVPPGYAPQTF	0.9947	0.5192	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A26:02	YVPPGYAPQTF	0.9874	0.5482	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C15:06	YAPQTFKRV	0.9954	0.8826	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C04:06	YAPQTFKRV	0.9946	0.9622	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C03:07	YAPQTFKRV	0.9921	0.9253	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B07:12	APQTFKRVL	0.9881	0.7092	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B42:02	APQTFKRVL	0.9733	0.5125	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A31:01	GYAPQTFKR	0.9674	0.7535	10	19
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C06:03	YAPQTFKRV	0.9568	0.9942	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B42:01	APQTFKRVL	0.9561	0.5134	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B51:07	YAPQTFKRV	0.9547	0.8046	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C12:04	YAPQTFKRV	0.9491	0.9937	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C12:12	YAPQTFKRV	0.9108	0.9657	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B14:03	APQTFKRVL	0.8415	0.7849	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C03:08	YAPQTFKRV	0.8296	0.8656	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A02:07	YAPQTFKRV	0.8056	0.7094	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C02:06	YAPQTFKRV	0.6067	0.9589	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B39:10	APQTFKRVL	0.6005	0.8803	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:17	YAPQTFKRV	0.4128	0.9662	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:30	YAPQTFKRV	0.363	0.9758	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B07:12	VPPGYAPQTF	0.9728	0.5401	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:17	YAPQTFKRVL	0.9507	0.9471	11	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B07:12	YAPQTFKRVL	0.9109	0.6447	11	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:30	YAPQTFKRVL	0.8556	0.9372	11	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:02	YVPPGYAPQTF	0.9991	0.7705	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:17	YVPPGYAPQTF	0.9972	0.9461	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:30	YVPPGYAPQTF	0.985	0.9567	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C03:14	YVPPGYAPQTF	0.9821	0.8548	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B07:09	APQTFKRVL	0.999	0.517	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C15:05	YAPQTFKRV	0.9962	0.9261	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C03:17	YAPQTFKRV	0.9663	0.9546	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C03:05	YAPQTFKRV	0.9557	0.9155	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C03:06	YAPQTFKRV	0.9331	0.9743	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C16:02	YAPQTFKRV	0.9138	0.9856	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C06:17	YAPQTFKRV	0.898	0.9937	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C06:02	YAPQTFKRV	0.898	0.9937	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C16:04	YAPQTFKRV	0.8899	0.9821	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C06:06	YAPQTFKRV	0.8743	0.986	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C12:03	YAPQTFKRV	0.8537	0.9865	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B08:12	APQTFKRVL	0.6648	0.6482	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B67:01	APQTFKRVL	0.6013	0.6863	12	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C06:08	YAPQTFKRV	0.4842	0.9895	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:03	YAPQTFKRV	0.4454	0.9679	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:02	YAPQTFKRV	0.4325	0.9642	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C07:04	YAPQTFKRV	0.3775	0.9374	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B07:13	YAPQTFKRV	0.2674	0.8796	11	20
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C03:05	YAPQTFKRVL	0.9916	0.8943	11	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C03:17	YAPQTFKRVL	0.9845	0.9533	11	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B15:08	VPPGYAPQTF	0.9668	0.6229	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B35:43	VPPGYAPQTF	0.9643	0.626	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B15:11	VPPGYAPQTF	0.9611	0.6351	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B35:23	VPPGYAPQTF	0.9478	0.5542	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:02	YAPQTFKRVL	0.9389	0.9431	11	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:03	YAPQTFKRVL	0.9197	0.9315	11	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B67:01	YAPQTFKRVL	0.7504	0.7192	11	21
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B51:06	VPPGYAPQTF	0.7458	0.5373	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B82:02	VPPGYAPQTF	0.6761	0.5785	7	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B15:11	YVPPGYAPQTF	0.9997	0.6173	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B15:08	YVPPGYAPQTF	0.9997	0.5994	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B35:43	YVPPGYAPQTF	0.9996	0.5996	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A24:03	YVPPGYAPQTF	0.9983	0.6544	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:02	YVPPGYAPQTF	0.9975	0.9429	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C01:03	YVPPGYAPQTF	0.9972	0.9615	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B15:13	YVPPGYAPQTF	0.9971	0.6624	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B35:77	YVPPGYAPQTF	0.9947	0.5192	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B35:23	YVPPGYAPQTF	0.9941	0.5513	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-A25:01	YVPPGYAPQTF	0.9932	0.872	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C02:10	YVPPGYAPQTF	0.9797	0.9203	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-C02:02	YVPPGYAPQTF	0.9797	0.9203	6	17
FNDC3A-RB1	chr13	49688867	chr13	49039134	171	HLA-B51:06	YVPPGYAPQTF	0.9537	0.5408	6	17

Top

Potential FusionNeoAntigen Information of FNDC3A-RB1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of FNDC3A-RB1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6861	PPGYAPQIMMCSMY	FNDC3A	RB1	chr13	49688867	chr13	49037867	171

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10848	YVPPGYAPQTFKRV	FNDC3A	RB1	chr13	49688867	chr13	49039134	171

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FNDC3A-RB1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6861	PPGYAPQIMMCSMY	-7.5588	-7.6706
HLA-B14:02	3BVN	6861	PPGYAPQIMMCSMY	-4.42712	-5.47022
HLA-B52:01	3W39	6861	PPGYAPQIMMCSMY	-5.79336	-5.90516
HLA-B52:01	3W39	6861	PPGYAPQIMMCSMY	-4.82735	-5.87045
HLA-A11:01	4UQ2	6861	PPGYAPQIMMCSMY	-10.3742	-10.486
HLA-A24:02	5HGA	6861	PPGYAPQIMMCSMY	-7.36249	-8.40559
HLA-A24:02	5HGA	6861	PPGYAPQIMMCSMY	-7.07591	-7.18771
HLA-B27:05	6PYJ	6861	PPGYAPQIMMCSMY	-8.75018	-8.86198
HLA-B44:05	3DX8	6861	PPGYAPQIMMCSMY	-5.28726	-5.39906
HLA-B44:05	3DX8	6861	PPGYAPQIMMCSMY	-4.30205	-5.34515
HLA-A02:01	6TDR	6861	PPGYAPQIMMCSMY	-4.2167	-4.3285
HLA-B14:02	3BVN	10848	YVPPGYAPQTFKRV	-5.68508	-5.79848
HLA-B14:02	3BVN	10848	YVPPGYAPQTFKRV	-4.48181	-5.51711
HLA-B52:01	3W39	10848	YVPPGYAPQTFKRV	-6.58333	-6.69673
HLA-B52:01	3W39	10848	YVPPGYAPQTFKRV	-5.63259	-6.66789
HLA-A11:01	4UQ2	10848	YVPPGYAPQTFKRV	-10.3303	-10.4437
HLA-A11:01	4UQ2	10848	YVPPGYAPQTFKRV	-6.29447	-7.32977
HLA-A24:02	5HGA	10848	YVPPGYAPQTFKRV	-7.77035	-7.88375
HLA-A24:02	5HGA	10848	YVPPGYAPQTFKRV	-5.35627	-6.39157
HLA-B27:05	6PYJ	10848	YVPPGYAPQTFKRV	-3.97515	-5.01045
HLA-B44:05	3DX8	10848	YVPPGYAPQTFKRV	-5.81963	-5.93303
HLA-B44:05	3DX8	10848	YVPPGYAPQTFKRV	-4.86027	-5.89557
HLA-A02:01	6TDR	10848	YVPPGYAPQTFKRV	-5.17978	-6.21508
HLA-A02:01	6TDR	10848	YVPPGYAPQTFKRV	-5.36237	-5.47577

Top

Vaccine Design for the FusionNeoAntigens of FNDC3A-RB1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
FNDC3A-RB1	chr13	49688867	chr13	49037867	10	19	APQIMMCSM	GCCCCACAGATTATGATGTGTTCCATG
FNDC3A-RB1	chr13	49688867	chr13	49037867	3	14	IYVPPGYAPQI	ATCTATGTGCCTCCTGGATATGCCCCACAGATT
FNDC3A-RB1	chr13	49688867	chr13	49037867	4	14	YVPPGYAPQI	TATGTGCCTCCTGGATATGCCCCACAGATT
FNDC3A-RB1	chr13	49688867	chr13	49037867	4	15	YVPPGYAPQIM	TATGTGCCTCCTGGATATGCCCCACAGATTATG
FNDC3A-RB1	chr13	49688867	chr13	49037867	5	14	VPPGYAPQI	GTGCCTCCTGGATATGCCCCACAGATT
FNDC3A-RB1	chr13	49688867	chr13	49037867	5	16	VPPGYAPQIMM	GTGCCTCCTGGATATGCCCCACAGATTATGATG
FNDC3A-RB1	chr13	49688867	chr13	49037867	8	16	GYAPQIMM	GGATATGCCCCACAGATTATGATG
FNDC3A-RB1	chr13	49688867	chr13	49037867	9	19	YAPQIMMCSM	TATGCCCCACAGATTATGATGTGTTCCATG
FNDC3A-RB1	chr13	49688867	chr13	49039134	10	19	GYAPQTFKR	GCCCCACAGACATTCAAACGTGTTTTG
FNDC3A-RB1	chr13	49688867	chr13	49039134	11	20	YAPQTFKRV	CCACAGACATTCAAACGTGTTTTGATC
FNDC3A-RB1	chr13	49688867	chr13	49039134	11	21	YAPQTFKRVL	CCACAGACATTCAAACGTGTTTTGATCAAA
FNDC3A-RB1	chr13	49688867	chr13	49039134	12	21	APQTFKRVL	CAGACATTCAAACGTGTTTTGATCAAA
FNDC3A-RB1	chr13	49688867	chr13	49039134	6	17	YVPPGYAPQTF	CCTCCTGGATATGCCCCACAGACATTCAAACGT
FNDC3A-RB1	chr13	49688867	chr13	49039134	7	17	VPPGYAPQTF	CCTGGATATGCCCCACAGACATTCAAACGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of FNDC3A-RB1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	FNDC3A-RB1	chr13	49688867	ENST00000398316	chr13	49037867	ENST00000267163	TCGA-C8-A12K-01A
BRCA	FNDC3A-RB1	chr13	49688867	ENST00000398316	chr13	49039134	ENST00000267163	TCGA-C8-A12K-01A

Top

Potential target of CAR-T therapy development for FNDC3A-RB1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to FNDC3A-RB1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to FNDC3A-RB1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)