|
|||||||
|
Fusion Protein:FOXP1-SH3RF2 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: FOXP1-SH3RF2 | FusionPDB ID: 31217 | FusionGDB2.0 ID: 31217 | Hgene | Tgene | Gene symbol | FOXP1 | SH3RF2 | Gene ID | 27086 | 153769 |
| Gene name | forkhead box P1 | SH3 domain containing ring finger 2 | |
| Synonyms | 12CC4|HSPC215|MFH|QRF1|hFKH1B | HEPP1|POSHER|PPP1R39|RNF158 | |
| Cytomap | 3p13 | 5q32 | |
| Type of gene | protein-coding | protein-coding | |
| Description | forkhead box protein P1fork head-related protein like Bglutamine-rich factor 1mac-1-regulated forkhead | E3 ubiquitin-protein ligase SH3RF2POSH-eliminating RING proteinRING finger protein 158RING-type E3 ubiquitin transferase SH3RF2SH3 domain-containing RING finger protein 2heart protein phosphatase 1-binding proteinphosphatase 1 binding proteinprotei | |
| Modification date | 20200329 | 20200313 | |
| UniProtAcc | Q9H334 Main function of 5'-partner protein: FUNCTION: Transcriptional repressor (PubMed:18347093, PubMed:26647308). Can act with CTBP1 to synergistically repress transcription but CTPBP1 is not essential (By similarity). Plays an important role in the specification and differentiation of lung epithelium. Acts cooperatively with FOXP4 to regulate lung secretory epithelial cell fate and regeneration by restricting the goblet cell lineage program; the function may involve regulation of AGR2. Essential transcriptional regulator of B-cell development. Involved in regulation of cardiac muscle cell proliferation. Involved in the columnar organization of spinal motor neurons. Promotes the formation of the lateral motor neuron column (LMC) and the preganglionic motor column (PGC) and is required for respective appropriate motor axon projections. The segment-appropriate generation of spinal chord motor columns requires cooperation with other Hox proteins. Can regulate PITX3 promoter activity; may promote midbrain identity in embryonic stem cell-derived dopamine neurons by regulating PITX3. Negatively regulates the differentiation of T follicular helper cells T(FH)s. Involved in maintenance of hair follicle stem cell quiescence; the function probably involves regulation of FGF18 (By similarity). Represses transcription of various pro-apoptotic genes and cooperates with NF-kappa B-signaling in promoting B-cell expansion by inhibition of caspase-dependent apoptosis (PubMed:25267198). Binds to CSF1R promoter elements and is involved in regulation of monocyte differentiation and macrophage functions; repression of CSF1R in monocytes seems to involve NCOR2 as corepressor (PubMed:15286807, PubMed:18799727, PubMed:18347093). Involved in endothelial cell proliferation, tube formation and migration indicative for a role in angiogenesis; the role in neovascularization seems to implicate suppression of SEMA5B (PubMed:24023716). Can negatively regulate androgen receptor signaling (PubMed:18640093). Acts as a transcriptional activator of the FBXL7 promoter; this activity is regulated by AURKA (PubMed:28218735). {ECO:0000250|UniProtKB:P58462, ECO:0000269|PubMed:15286807, ECO:0000269|PubMed:18640093, ECO:0000269|PubMed:18799727, ECO:0000269|PubMed:24023716, ECO:0000269|PubMed:25267198, ECO:0000269|PubMed:26647308, ECO:0000269|PubMed:28218735, ECO:0000305|PubMed:18347093, ECO:0000305|PubMed:24023716}.; FUNCTION: [Isoform 8]: Involved in transcriptional regulation in embryonic stem cells (ESCs). Stimulates expression of transcription factors that are required for pluripotency and decreases expression of differentiation-associated genes. Has distinct DNA-binding specifities as compared to the canonical form and preferentially binds DNA with the sequence 5'-CGATACAA-3' (or closely related sequences) (PubMed:21924763). Promotes ESC self-renewal and pluripotency (By similarity). {ECO:0000250|UniProtKB:P58462, ECO:0000269|PubMed:21924763}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000318789, ENST00000468577, ENST00000475937, ENST00000484350, ENST00000491238, ENST00000493089, ENST00000498215, ENST00000472382, ENST00000318779, | ENST00000511705, ENST00000359120, ENST00000511217, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 34 X 30 X 13=13260 | 3 X 2 X 3=18 |
| # samples | 38 | 3 | |
| ** MAII score | log2(38/13260*10)=-5.124937546669 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
| Fusion gene context | PubMed: FOXP1 [Title/Abstract] AND SH3RF2 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: FOXP1 [Title/Abstract] AND SH3RF2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FOXP1(71090479)-SH3RF2(145379621), # samples:3 | ||
| Anticipated loss of major functional domain due to fusion event. | FOXP1-SH3RF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FOXP1-SH3RF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FOXP1-SH3RF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FOXP1-SH3RF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FOXP1-SH3RF2 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. FOXP1-SH3RF2 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. FOXP1-SH3RF2 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. FOXP1-SH3RF2 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. FOXP1-SH3RF2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | FOXP1 | GO:0002903 | negative regulation of B cell apoptotic process | 25267198 |
| Hgene | FOXP1 | GO:0010629 | negative regulation of gene expression | 30111844 |
| Hgene | FOXP1 | GO:0030316 | osteoclast differentiation | 18799727 |
| Hgene | FOXP1 | GO:0032496 | response to lipopolysaccharide | 18799727 |
| Hgene | FOXP1 | GO:0032680 | regulation of tumor necrosis factor production | 18799727 |
| Hgene | FOXP1 | GO:0035926 | chemokine (C-C motif) ligand 2 secretion | 18799727 |
| Hgene | FOXP1 | GO:0036035 | osteoclast development | 18799727 |
| Hgene | FOXP1 | GO:0042116 | macrophage activation | 18799727 |
| Hgene | FOXP1 | GO:0042117 | monocyte activation | 18799727 |
| Hgene | FOXP1 | GO:0045655 | regulation of monocyte differentiation | 15286807 |
| Hgene | FOXP1 | GO:0045892 | negative regulation of transcription, DNA-templated | 20950788 |
| Hgene | FOXP1 | GO:0050706 | regulation of interleukin-1 beta secretion | 18799727 |
| Hgene | FOXP1 | GO:0050727 | regulation of inflammatory response | 18799727 |
| Hgene | FOXP1 | GO:0060766 | negative regulation of androgen receptor signaling pathway | 18640093 |
| Hgene | FOXP1 | GO:1900424 | regulation of defense response to bacterium | 18799727 |
| Hgene | FOXP1 | GO:1901256 | regulation of macrophage colony-stimulating factor production | 18799727 |
| Hgene | FOXP1 | GO:2001182 | regulation of interleukin-12 secretion | 18799727 |
| Tgene | SH3RF2 | GO:0010923 | negative regulation of phosphatase activity | 19389623 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:71090479/chr5:145379621) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across FOXP1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across SH3RF2 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000318789 | FOXP1 | chr3 | 71090479 | - | ENST00000359120 | SH3RF2 | chr5 | 145379621 | + | 3822 | 1395 | 1218 | 3206 | 662 |
| ENST00000318789 | FOXP1 | chr3 | 71090479 | - | ENST00000511217 | SH3RF2 | chr5 | 145379621 | + | 6572 | 1395 | 1218 | 3206 | 662 |
| ENST00000493089 | FOXP1 | chr3 | 71090479 | - | ENST00000359120 | SH3RF2 | chr5 | 145379621 | + | 3925 | 1498 | 1321 | 3309 | 662 |
| ENST00000493089 | FOXP1 | chr3 | 71090479 | - | ENST00000511217 | SH3RF2 | chr5 | 145379621 | + | 6675 | 1498 | 1321 | 3309 | 662 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000318789 | ENST00000359120 | FOXP1 | chr3 | 71090479 | - | SH3RF2 | chr5 | 145379621 | + | 0.04314931 | 0.9568507 |
| ENST00000318789 | ENST00000511217 | FOXP1 | chr3 | 71090479 | - | SH3RF2 | chr5 | 145379621 | + | 0.007381245 | 0.99261874 |
| ENST00000493089 | ENST00000359120 | FOXP1 | chr3 | 71090479 | - | SH3RF2 | chr5 | 145379621 | + | 0.043748043 | 0.9562519 |
| ENST00000493089 | ENST00000511217 | FOXP1 | chr3 | 71090479 | - | SH3RF2 | chr5 | 145379621 | + | 0.006628636 | 0.99337137 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FOXP1-SH3RF2 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| FOXP1 | chr3 | 71090479 | SH3RF2 | chr5 | 145379621 | 1395 | 59 | QWTALSPHSQKGKVPRAKALCNYRGQ |
| FOXP1 | chr3 | 71090479 | SH3RF2 | chr5 | 145379621 | 1498 | 59 | QWTALSPHSQKGKVPRAKALCNYRGQ |
Top |
Potential FusionNeoAntigen Information of FOXP1-SH3RF2 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| FOXP1-SH3RF2_71090479_145379621.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-A31:02 | HSQKGKVPR | 0.9367 | 0.5335 | 7 | 16 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-B14:02 | GKVPRAKAL | 0.91 | 0.8233 | 11 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-B14:01 | GKVPRAKAL | 0.91 | 0.8233 | 11 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-B07:10 | GKVPRAKAL | 0.0122 | 0.6572 | 11 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-A02:13 | ALSPHSQKGKV | 0.9424 | 0.5695 | 3 | 14 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-C01:17 | KVPRAKAL | 0.9439 | 0.9526 | 12 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-C01:30 | KVPRAKAL | 0.9147 | 0.9588 | 12 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-B15:04 | SQKGKVPRA | 0.8382 | 0.902 | 8 | 17 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-B14:03 | GKVPRAKAL | 0.4044 | 0.802 | 11 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-C01:02 | KVPRAKAL | 0.9218 | 0.953 | 12 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-C01:03 | KVPRAKAL | 0.8665 | 0.9536 | 12 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-A30:01 | KGKVPRAKA | 0.9628 | 0.8633 | 10 | 19 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-A30:01 | SQKGKVPRA | 0.9384 | 0.7867 | 8 | 17 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-B67:01 | SPHSQKGKV | 0.1757 | 0.6098 | 5 | 14 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-B15:68 | GKVPRAKAL | 0.1228 | 0.6274 | 11 | 20 |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 | HLA-A30:01 | SQKGKVPRAK | 0.9852 | 0.7774 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of FOXP1-SH3RF2 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of FOXP1-SH3RF2 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 6691 | PHSQKGKVPRAKAL | FOXP1 | SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 1395 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FOXP1-SH3RF2 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 6691 | PHSQKGKVPRAKAL | -6.77781 | -6.89121 |
| HLA-B14:02 | 3BVN | 6691 | PHSQKGKVPRAKAL | -3.08719 | -4.12249 |
| HLA-B52:01 | 3W39 | 6691 | PHSQKGKVPRAKAL | -6.66315 | -6.77655 |
| HLA-B52:01 | 3W39 | 6691 | PHSQKGKVPRAKAL | -2.65785 | -3.69315 |
| HLA-A24:02 | 5HGA | 6691 | PHSQKGKVPRAKAL | -7.20627 | -7.31967 |
| HLA-A24:02 | 5HGA | 6691 | PHSQKGKVPRAKAL | -6.50211 | -7.53741 |
| HLA-B44:05 | 3DX8 | 6691 | PHSQKGKVPRAKAL | -7.75024 | -7.86364 |
| HLA-B44:05 | 3DX8 | 6691 | PHSQKGKVPRAKAL | -6.53073 | -7.56603 |
| HLA-A02:01 | 6TDR | 6691 | PHSQKGKVPRAKAL | -4.4528 | -5.4881 |
Top |
Vaccine Design for the FusionNeoAntigens of FOXP1-SH3RF2 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 10 | 19 | KGKVPRAKA | AAGGGAAAGGTGCCTCGAGCAAAGGCC |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 11 | 20 | GKVPRAKAL | GGAAAGGTGCCTCGAGCAAAGGCCTTA |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 12 | 20 | KVPRAKAL | AAGGTGCCTCGAGCAAAGGCCTTA |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 3 | 14 | ALSPHSQKGKV | GCTCTCAGTCCACACTCCCAAAAGGGAAAGGTG |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 5 | 14 | SPHSQKGKV | AGTCCACACTCCCAAAAGGGAAAGGTG |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 7 | 16 | HSQKGKVPR | CACTCCCAAAAGGGAAAGGTGCCTCGA |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 8 | 17 | SQKGKVPRA | TCCCAAAAGGGAAAGGTGCCTCGAGCA |
| FOXP1-SH3RF2 | chr3 | 71090479 | chr5 | 145379621 | 8 | 18 | SQKGKVPRAK | TCCCAAAAGGGAAAGGTGCCTCGAGCAAAG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of FOXP1-SH3RF2 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| CHOL | FOXP1-SH3RF2 | chr3 | 71090479 | ENST00000318789 | chr5 | 145379621 | ENST00000359120 | TCGA-WD-A7RX-01A |
Top |
Potential target of CAR-T therapy development for FOXP1-SH3RF2 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FOXP1-SH3RF2 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FOXP1-SH3RF2 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies