Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GAK-LUC7L3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GAK-LUC7L3
	FusionPDB ID: 32173
	FusionGDB2.0 ID: 32173
		Hgene	Tgene
	Gene symbol	GAK	LUC7L3
	Gene ID	2580	51747
	Gene name	cyclin G associated kinase	LUC7 like 3 pre-mRNA splicing factor
	Synonyms	DNAJ26\|DNAJC26	CRA\|CREAP-1\|CROP\|LUC7A\|OA48-18\|hLuc7A
	Cytomap	4p16.3	17q21.33
	Type of gene	protein-coding	protein-coding
	Description	cyclin-G-associated kinaseauxilin-2	luc7-like protein 3CRE-associated protein 1LUC7-like 3cAMP regulatory element-associated protein 1cisplatin resistance-associated-overexpressed proteinokadaic acid-inducible phosphoprotein OA48-18
	Modification date	20200313	20200313
	UniProtAcc	O14976 Main function of 5'-partner protein: FUNCTION: Associates with cyclin G and CDK5. Seems to act as an auxilin homolog that is involved in the uncoating of clathrin-coated vesicles by Hsc70 in non-neuronal cells. Expression oscillates slightly during the cell cycle, peaking at G1. {ECO:0000269\|PubMed:10625686}.	O95232 Main function of 5'-partner protein: FUNCTION: Binds cAMP regulatory element DNA sequence. May play a role in RNA splicing. {ECO:0000269\|PubMed:16462885}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000314167, ENST00000509566, ENST00000511163,	ENST00000240304, ENST00000311571, ENST00000393227, ENST00000503798, ENST00000505658, ENST00000544170,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	16 X 17 X 8=2176	8 X 8 X 5=320
	# samples	18	9
	** MAII score	log2(18/2176*10)=-3.59560974492067 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/320*10)=-1.83007499855769 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GAK [Title/Abstract] AND LUC7L3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GAK [Title/Abstract] AND LUC7L3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GAK(925831)-LUC7L3(48814321), # samples:1 GAK(925830)-LUC7L3(48814320), # samples:1 GAK(843066)-LUC7L3(48834056), # samples:1
Anticipated loss of major functional domain due to fusion event.	GAK-LUC7L3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GAK-LUC7L3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GAK-LUC7L3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GAK-LUC7L3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	GAK	GO:0010977	negative regulation of neuron projection development	24510904

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:925831/chr17:48814321)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GAK (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LUC7L3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000314167	GAK	chr4	925831	-	ENST00000505658	LUC7L3	chr17	48814321	+	7008	256	82	1455	457
ENST00000314167	GAK	chr4	925831	-	ENST00000393227	LUC7L3	chr17	48814321	+	2307	256	82	1626	514
ENST00000314167	GAK	chr4	925831	-	ENST00000311571	LUC7L3	chr17	48814321	+	397	256	82	396	105
ENST00000314167	GAK	chr4	925831	-	ENST00000240304	LUC7L3	chr17	48814321	+	1999	256	82	1455	457
ENST00000511163	GAK	chr4	925831	-	ENST00000505658	LUC7L3	chr17	48814321	+	7083	331	157	1530	457
ENST00000511163	GAK	chr4	925831	-	ENST00000393227	LUC7L3	chr17	48814321	+	2382	331	157	1701	514
ENST00000511163	GAK	chr4	925831	-	ENST00000311571	LUC7L3	chr17	48814321	+	472	331	157	471	105
ENST00000511163	GAK	chr4	925831	-	ENST00000240304	LUC7L3	chr17	48814321	+	2074	331	157	1530	457
ENST00000314167	GAK	chr4	925830	-	ENST00000505658	LUC7L3	chr17	48814320	+	7008	256	82	1455	457
ENST00000314167	GAK	chr4	925830	-	ENST00000393227	LUC7L3	chr17	48814320	+	2307	256	82	1626	514
ENST00000314167	GAK	chr4	925830	-	ENST00000311571	LUC7L3	chr17	48814320	+	397	256	82	396	105
ENST00000314167	GAK	chr4	925830	-	ENST00000240304	LUC7L3	chr17	48814320	+	1999	256	82	1455	457
ENST00000511163	GAK	chr4	925830	-	ENST00000505658	LUC7L3	chr17	48814320	+	7083	331	157	1530	457
ENST00000511163	GAK	chr4	925830	-	ENST00000393227	LUC7L3	chr17	48814320	+	2382	331	157	1701	514
ENST00000511163	GAK	chr4	925830	-	ENST00000311571	LUC7L3	chr17	48814320	+	472	331	157	471	105
ENST00000511163	GAK	chr4	925830	-	ENST00000240304	LUC7L3	chr17	48814320	+	2074	331	157	1530	457

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000314167	ENST00000505658	GAK	chr4	925831	-	LUC7L3	chr17	48814321	+	8.62E-05	0.9999138
ENST00000314167	ENST00000393227	GAK	chr4	925831	-	LUC7L3	chr17	48814321	+	0.000482411	0.99951756
ENST00000314167	ENST00000311571	GAK	chr4	925831	-	LUC7L3	chr17	48814321	+	0.27648285	0.7235171
ENST00000314167	ENST00000240304	GAK	chr4	925831	-	LUC7L3	chr17	48814321	+	0.0009182	0.99908185
ENST00000511163	ENST00000505658	GAK	chr4	925831	-	LUC7L3	chr17	48814321	+	8.61E-05	0.99991393
ENST00000511163	ENST00000393227	GAK	chr4	925831	-	LUC7L3	chr17	48814321	+	0.00047482	0.9995252
ENST00000511163	ENST00000311571	GAK	chr4	925831	-	LUC7L3	chr17	48814321	+	0.2137297	0.7862703
ENST00000511163	ENST00000240304	GAK	chr4	925831	-	LUC7L3	chr17	48814321	+	0.000798584	0.9992015
ENST00000314167	ENST00000505658	GAK	chr4	925830	-	LUC7L3	chr17	48814320	+	8.62E-05	0.9999138
ENST00000314167	ENST00000393227	GAK	chr4	925830	-	LUC7L3	chr17	48814320	+	0.000482411	0.99951756
ENST00000314167	ENST00000311571	GAK	chr4	925830	-	LUC7L3	chr17	48814320	+	0.27648285	0.7235171
ENST00000314167	ENST00000240304	GAK	chr4	925830	-	LUC7L3	chr17	48814320	+	0.0009182	0.99908185
ENST00000511163	ENST00000505658	GAK	chr4	925830	-	LUC7L3	chr17	48814320	+	8.61E-05	0.99991393
ENST00000511163	ENST00000393227	GAK	chr4	925830	-	LUC7L3	chr17	48814320	+	0.00047482	0.9995252
ENST00000511163	ENST00000311571	GAK	chr4	925830	-	LUC7L3	chr17	48814320	+	0.2137297	0.7862703
ENST00000511163	ENST00000240304	GAK	chr4	925830	-	LUC7L3	chr17	48814320	+	0.000798584	0.9992015

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GAK-LUC7L3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GAK	chr4	925830	LUC7L3	chr17	48814320	256	58	ASCGCGCGGSWPKVCKYYLCGFCPAE
GAK	chr4	925830	LUC7L3	chr17	48814320	331	58	ASCGCGCGGSWPKVCKYYLCGFCPAE
GAK	chr4	925831	LUC7L3	chr17	48814321	256	58	ASCGCGCGGSWPKVCKYYLCGFCPAE
GAK	chr4	925831	LUC7L3	chr17	48814321	331	58	ASCGCGCGGSWPKVCKYYLCGFCPAE

Top

Potential FusionNeoAntigen Information of GAK-LUC7L3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GAK-LUC7L3_925830_48814320.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:17	GSWPKVCKY	0.9891	0.7539	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:25	GSWPKVCKY	0.987	0.847	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B57:01	GSWPKVCKY	0.9851	0.9005	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B58:02	GSWPKVCKY	0.9656	0.8313	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B58:01	GSWPKVCKY	0.9554	0.7502	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:16	GSWPKVCKY	0.9163	0.5493	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-A32:13	GSWPKVCKY	0.1849	0.9291	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:07	GSWPKVCKY	0.8847	0.5153	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:05	GSWPKVCKY	0.8636	0.7741	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C07:19	GSWPKVCKY	0.7922	0.5249	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C15:04	GSWPKVCKY	0.6538	0.7922	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C12:04	GSWPKVCKY	0.0923	0.989	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C06:03	GSWPKVCKY	0.0915	0.9869	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C03:14	GSWPKVCKY	0.0724	0.9602	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C12:12	GSWPKVCKY	0.0116	0.8797	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B57:04	GSWPKVCKY	0.9879	0.6728	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B57:10	GSWPKVCKY	0.9851	0.9005	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:39	GSWPKVCKY	0.9845	0.6823	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B58:06	GSWPKVCKY	0.9728	0.6633	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:135	GSWPKVCKY	0.8881	0.8122	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:50	GSWPKVCKY	0.8659	0.8326	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:20	GSWPKVCKY	0.8633	0.8684	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:24	GSWPKVCKY	0.8263	0.7465	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B15:35	GSWPKVCKY	0.8221	0.7629	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-B35:28	GSWPKVCKY	0.8061	0.8707	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-A32:01	GSWPKVCKY	0.7692	0.861	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C15:09	GSWPKVCKY	0.6538	0.7922	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C16:04	GSWPKVCKY	0.32	0.9618	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C16:01	GSWPKVCKY	0.2594	0.9696	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C12:02	GSWPKVCKY	0.0911	0.9387	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C12:03	GSWPKVCKY	0.0579	0.9562	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C16:02	GSWPKVCKY	0.041	0.9882	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C02:02	GSWPKVCKY	0.0014	0.9578	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C02:10	GSWPKVCKY	0.0014	0.9578	8	17
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C14:02	SWPKVCKYY	0.0012	0.8906	9	18
GAK-LUC7L3	chr4	925830	chr17	48814320	256	HLA-C14:03	SWPKVCKYY	0.0012	0.8906	9	18

Top

Potential FusionNeoAntigen Information of GAK-LUC7L3 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of GAK-LUC7L3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
821	CGGSWPKVCKYYLC	GAK	LUC7L3	chr4	925830	chr17	48814320	256

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GAK-LUC7L3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	821	CGGSWPKVCKYYLC	-7.00905	-7.12245
HLA-B14:02	3BVN	821	CGGSWPKVCKYYLC	-6.92134	-7.95664
HLA-B52:01	3W39	821	CGGSWPKVCKYYLC	-6.19188	-6.30528
HLA-B52:01	3W39	821	CGGSWPKVCKYYLC	-5.2073	-6.2426
HLA-A11:01	4UQ2	821	CGGSWPKVCKYYLC	-9.86428	-9.97768
HLA-A11:01	4UQ2	821	CGGSWPKVCKYYLC	-4.30616	-5.34146
HLA-A24:02	5HGA	821	CGGSWPKVCKYYLC	-7.39206	-7.50546
HLA-A24:02	5HGA	821	CGGSWPKVCKYYLC	-6.80116	-7.83646
HLA-B27:05	6PYJ	821	CGGSWPKVCKYYLC	-3.02312	-4.05842
HLA-B44:05	3DX8	821	CGGSWPKVCKYYLC	-6.44332	-6.55672
HLA-B44:05	3DX8	821	CGGSWPKVCKYYLC	-5.28242	-6.31772
HLA-A02:01	6TDR	821	CGGSWPKVCKYYLC	-5.57881	-5.69221

Top

Vaccine Design for the FusionNeoAntigens of GAK-LUC7L3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GAK-LUC7L3	chr4	925830	chr17	48814320	8	17	GSWPKVCKY	GGGTCCTGGCCGAAGGTTTGTAAATAT
GAK-LUC7L3	chr4	925830	chr17	48814320	9	18	SWPKVCKYY	TCCTGGCCGAAGGTTTGTAAATATTAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of GAK-LUC7L3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	GAK-LUC7L3	chr4	925830	ENST00000314167	chr17	48814320	ENST00000240304	TCGA-CU-A5W6

Top

Potential target of CAR-T therapy development for GAK-LUC7L3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GAK-LUC7L3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GAK-LUC7L3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)