Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GNPAT-LGALS8

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GNPAT-LGALS8
	FusionPDB ID: 33806
	FusionGDB2.0 ID: 33806
		Hgene	Tgene
	Gene symbol	GNPAT	LGALS8
	Gene ID	8443	3964
	Gene name	glyceronephosphate O-acyltransferase	galectin 8
	Synonyms	DAP-AT\|DAPAT\|DHAPAT\|RCDP2	Gal-8\|PCTA-1\|PCTA1\|Po66-CBP
	Cytomap	1q42.2	1q43
	Type of gene	protein-coding	protein-coding
	Description	dihydroxyacetone phosphate acyltransferaseDHAP-ATacyl-CoA:dihydroxyacetonephosphateacyltransferaseglycerone-phosphate O-acyltransferase	galectin-8Po66 carbohydrate binding proteingalectin-8glectin, galactoside-binding, soluble, 8po66 carbohydrate-binding proteinprostate carcinoma tumor antigen 1
	Modification date	20200313	20200327
	UniProtAcc	O15228 Main function of 5'-partner protein: FUNCTION: Dihydroxyacetonephosphate acyltransferase involved in plasmalogen biosynthesis. {ECO:0000269\|PubMed:15687349}.	O00214 Main function of 5'-partner protein: FUNCTION: Beta-galactoside-binding lectin that acts as a sensor of membrane damage caused by infection and restricts the proliferation of infecting pathogens by targeting them for autophagy (PubMed:22246324, PubMed:28077878). Detects membrane rupture by binding beta-galactoside ligands located on the lumenal side of the endosome membrane; these ligands becoming exposed to the cytoplasm following rupture (PubMed:22246324, PubMed:28077878). Restricts infection by initiating autophagy via interaction with CALCOCO2/NDP52 (PubMed:22246324, PubMed:28077878). Required to restrict infection of bacterial invasion such as S.typhimurium (PubMed:22246324). Also required to restrict infection of Picornaviridae viruses (PubMed:28077878). Has a marked preference for 3'-O-sialylated and 3'-O-sulfated glycans (PubMed:21288902). {ECO:0000269\|PubMed:21288902, ECO:0000269\|PubMed:22246324, ECO:0000269\|PubMed:28077878}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000366646, ENST00000366647, ENST00000469332,	ENST00000323938, ENST00000341872, ENST00000352231, ENST00000366584, ENST00000416919, ENST00000450372, ENST00000525042, ENST00000526589, ENST00000526634, ENST00000527974,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 5 X 6=180	5 X 6 X 3=90
	# samples	7	6
	** MAII score	log2(7/180*10)=-1.36257007938471 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/90*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GNPAT [Title/Abstract] AND LGALS8 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GNPAT [Title/Abstract] AND LGALS8 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GNPAT(231396429)-LGALS8(236706860), # samples:1
Anticipated loss of major functional domain due to fusion event.	GNPAT-LGALS8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GNPAT-LGALS8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GNPAT-LGALS8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GNPAT-LGALS8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	GNPAT	GO:0008611	ether lipid biosynthetic process	15687349
Tgene	LGALS8	GO:1904977	lymphatic endothelial cell migration	19268462

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:231396429/chr1:236706860)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GNPAT (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LGALS8 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000526589	LGALS8	chr1	236706860	+	5832	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000527974	LGALS8	chr1	236706860	+	1132	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000352231	LGALS8	chr1	236706860	+	1134	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000341872	LGALS8	chr1	236706860	+	2114	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000450372	LGALS8	chr1	236706860	+	2547	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000366584	LGALS8	chr1	236706860	+	3861	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000416919	LGALS8	chr1	236706860	+	1074	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000323938	LGALS8	chr1	236706860	+	1853	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000526634	LGALS8	chr1	236706860	+	1647	607	169	1011	280
ENST00000366647	GNPAT	chr1	231396429	+	ENST00000525042	LGALS8	chr1	236706860	+	1012	607	169	1011	281
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000526589	LGALS8	chr1	236706860	+	5647	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000527974	LGALS8	chr1	236706860	+	947	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000352231	LGALS8	chr1	236706860	+	949	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000341872	LGALS8	chr1	236706860	+	1929	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000450372	LGALS8	chr1	236706860	+	2362	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000366584	LGALS8	chr1	236706860	+	3676	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000416919	LGALS8	chr1	236706860	+	889	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000323938	LGALS8	chr1	236706860	+	1668	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000526634	LGALS8	chr1	236706860	+	1462	422	167	826	219
ENST00000366646	GNPAT	chr1	231396429	+	ENST00000525042	LGALS8	chr1	236706860	+	827	422	167	826	220

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000366647	ENST00000526589	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.001024815	0.99897516
ENST00000366647	ENST00000527974	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.001895527	0.99810445
ENST00000366647	ENST00000352231	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.001848421	0.9981516
ENST00000366647	ENST00000341872	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.002035914	0.99796414
ENST00000366647	ENST00000450372	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.001607624	0.9983924
ENST00000366647	ENST00000366584	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.001113255	0.99888676
ENST00000366647	ENST00000416919	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.002231397	0.99776864
ENST00000366647	ENST00000323938	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.001276855	0.9987231
ENST00000366647	ENST00000526634	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.001032556	0.9989674
ENST00000366647	ENST00000525042	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.001931305	0.99806875
ENST00000366646	ENST00000526589	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.002779973	0.99722004
ENST00000366646	ENST00000527974	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.007702401	0.9922976
ENST00000366646	ENST00000352231	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.007444196	0.9925558
ENST00000366646	ENST00000341872	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.004403182	0.9955968
ENST00000366646	ENST00000450372	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.003439189	0.99656075
ENST00000366646	ENST00000366584	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.002320133	0.9976799
ENST00000366646	ENST00000416919	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.008417923	0.9915821
ENST00000366646	ENST00000323938	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.00297589	0.9970241
ENST00000366646	ENST00000526634	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.002922667	0.99707735
ENST00000366646	ENST00000525042	GNPAT	chr1	231396429	+	LGALS8	chr1	236706860	+	0.006264147	0.9937358

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GNPAT-LGALS8

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GNPAT	chr1	231396429	LGALS8	chr1	236706860	422	85	FSKVCVNEEGIQKRLPFAARLNTPMG
GNPAT	chr1	231396429	LGALS8	chr1	236706860	607	146	FSKVCVNEEGIQKRLPFAARLNTPMG

Top

Potential FusionNeoAntigen Information of GNPAT-LGALS8 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GNPAT-LGALS8_231396429_236706860.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:04	KRLPFAARL	0.9999	0.6969	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:05	KRLPFAARL	0.9999	0.8188	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:03	NEEGIQKRL	0.997	0.8767	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B39:24	KRLPFAARL	0.991	0.612	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B45:01	EEGIQKRLP	0.9893	0.6789	7	16
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B08:09	IQKRLPFAA	0.9839	0.544	10	19
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B18:01	NEEGIQKRL	0.9707	0.9212	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B14:01	KRLPFAARL	0.9532	0.8011	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B14:02	KRLPFAARL	0.9532	0.8011	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B39:06	IQKRLPFAA	0.8951	0.7039	10	19
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B38:02	KRLPFAARL	0.8769	0.9717	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B39:13	NEEGIQKRL	0.5816	0.8792	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:05	QKRLPFAARL	0.9996	0.5979	11	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:04	QKRLPFAARL	0.9994	0.5964	11	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:03	EEGIQKRLPF	0.9968	0.8245	7	17
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:03	NEEGIQKRLPF	0.9984	0.7914	6	17
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:14	KRLPFAARL	0.9999	0.7545	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:95	KRLPFAARL	0.9988	0.8298	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:03	KRLPFAARL	0.9979	0.8432	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:05	KRLPFAARL	0.9963	0.9638	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:13	KRLPFAARL	0.9935	0.9473	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:29	KRLPFAARL	0.993	0.9573	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:27	KRLPFAARL	0.9892	0.9653	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:46	KRLPFAARL	0.9813	0.9409	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:19	KRLPFAARL	0.9702	0.8592	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:10	KRLPFAARL	0.9594	0.9667	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B39:12	KRLPFAARL	0.9534	0.9115	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:80	KRLPFAARL	0.9483	0.9673	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:67	KRLPFAARL	0.9483	0.9673	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B15:04	IQKRLPFAA	0.8342	0.7186	10	19
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B39:08	NEEGIQKRL	0.6479	0.6942	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C12:16	KRLPFAARL	0.036	0.9738	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:03	QKRLPFAARL	0.9795	0.6395	11	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:08	KRLPFAARL	0.9999	0.7268	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:06	KRLPFAARL	0.9999	0.7184	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:10	KRLPFAARL	0.9999	0.8368	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:09	KRLPFAARL	0.9998	0.7855	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:01	KRLPFAARL	0.9991	0.7802	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:13	NEEGIQKRL	0.997	0.8767	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:07	NEEGIQKRL	0.997	0.8767	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:26	NEEGIQKRL	0.997	0.8767	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:17	KRLPFAARL	0.9859	0.9718	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C06:08	KRLPFAARL	0.9774	0.9837	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B18:05	NEEGIQKRL	0.9707	0.9212	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B18:03	NEEGIQKRL	0.9557	0.9136	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B39:31	KRLPFAARL	0.9554	0.9068	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B18:06	NEEGIQKRL	0.9543	0.927	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:02	KRLPFAARL	0.9483	0.9673	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:22	KRLPFAARL	0.8876	0.821	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C07:04	KRLPFAARL	0.8781	0.9474	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B18:11	NEEGIQKRL	0.79	0.8707	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B39:11	NEEGIQKRL	0.6362	0.6489	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B39:02	NEEGIQKRL	0.5814	0.8746	6	15
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C06:06	KRLPFAARL	0.3868	0.986	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C04:04	KRLPFAARL	0.2553	0.9309	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C18:01	KRLPFAARL	0.1987	0.9005	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C06:17	KRLPFAARL	0.0543	0.9926	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-C06:02	KRLPFAARL	0.0543	0.9926	12	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:06	QKRLPFAARL	0.9995	0.5991	11	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:08	QKRLPFAARL	0.9995	0.5141	11	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B27:09	QKRLPFAARL	0.999	0.5756	11	21
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:26	EEGIQKRLPF	0.9968	0.8245	7	17
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:13	EEGIQKRLPF	0.9968	0.8245	7	17
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:07	EEGIQKRLPF	0.9968	0.8245	7	17
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:13	NEEGIQKRLPF	0.9984	0.7914	6	17
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:07	NEEGIQKRLPF	0.9984	0.7914	6	17
GNPAT-LGALS8	chr1	231396429	chr1	236706860	422	HLA-B44:26	NEEGIQKRLPF	0.9984	0.7914	6	17

Top

Potential FusionNeoAntigen Information of GNPAT-LGALS8 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of GNPAT-LGALS8

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6130	NEEGIQKRLPFAAR	GNPAT	LGALS8	chr1	231396429	chr1	236706860	422

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GNPAT-LGALS8

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6130	NEEGIQKRLPFAAR	-6.07233	-6.07953
HLA-B52:01	3W39	6130	NEEGIQKRLPFAAR	-5.45645	-5.46365
HLA-A24:02	5HGA	6130	NEEGIQKRLPFAAR	-3.85827	-3.86547
HLA-B44:05	3DX8	6130	NEEGIQKRLPFAAR	-4.76301	-4.77021

Top

Vaccine Design for the FusionNeoAntigens of GNPAT-LGALS8

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GNPAT-LGALS8	chr1	231396429	chr1	236706860	10	19	IQKRLPFAA	ATTCAGAAAAGGCTGCCATTCGCTGCA
GNPAT-LGALS8	chr1	231396429	chr1	236706860	11	21	QKRLPFAARL	CAGAAAAGGCTGCCATTCGCTGCAAGGTTG
GNPAT-LGALS8	chr1	231396429	chr1	236706860	12	21	KRLPFAARL	AAAAGGCTGCCATTCGCTGCAAGGTTG
GNPAT-LGALS8	chr1	231396429	chr1	236706860	6	15	NEEGIQKRL	AATGAAGAAGGTATTCAGAAAAGGCTG
GNPAT-LGALS8	chr1	231396429	chr1	236706860	6	17	NEEGIQKRLPF	AATGAAGAAGGTATTCAGAAAAGGCTGCCATTC
GNPAT-LGALS8	chr1	231396429	chr1	236706860	7	16	EEGIQKRLP	GAAGAAGGTATTCAGAAAAGGCTGCCA
GNPAT-LGALS8	chr1	231396429	chr1	236706860	7	17	EEGIQKRLPF	GAAGAAGGTATTCAGAAAAGGCTGCCATTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of GNPAT-LGALS8

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	GNPAT-LGALS8	chr1	231396429	ENST00000366646	chr1	236706860	ENST00000323938	TCGA-BR-A4PE-01A

Top

Potential target of CAR-T therapy development for GNPAT-LGALS8

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GNPAT-LGALS8

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GNPAT-LGALS8

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)