![]() |
|||||||
|
Fusion Protein:GOLGA8A-DDB2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: GOLGA8A-DDB2 | FusionPDB ID: 33925 | FusionGDB2.0 ID: 33925 | Hgene | Tgene | Gene symbol | GOLGA8A | DDB2 | Gene ID | 23015 | 1643 |
Gene name | golgin A8 family member A | damage specific DNA binding protein 2 | |
Synonyms | CFAP286|FAP286|GM88|GOLGA8B | DDBB|UV-DDB2|XPE | |
Cytomap | 15q14 | 11p11.2 | |
Type of gene | protein-coding | protein-coding | |
Description | golgin subfamily A member 8A88 kDa Golgi matrix protein88-kDa golgi proteinGM88 autoantigenGolgin subfamily A member 8Bgolgi autoantigen, golgin subfamily a, 8Agolgin-67 | DNA damage-binding protein 2DDB p48 subunitUV-DDB 2UV-damaged DNA-binding protein 2damage-specific DNA binding protein 2, 48kDaxeroderma pigmentosum group E protein | |
Modification date | 20200313 | 20200327 | |
UniProtAcc | A7E2F4 Main function of 5'-partner protein: FUNCTION: May be involved in maintaining Golgi structure. {ECO:0000250}. | Q92466 Main function of 5'-partner protein: FUNCTION: Protein, which is both involved in DNA repair and protein ubiquitination, as part of the UV-DDB complex and DCX (DDB1-CUL4-X-box) complexes, respectively (PubMed:10882109, PubMed:11278856, PubMed:11705987, PubMed:9892649, PubMed:12732143, PubMed:15882621, PubMed:16473935, PubMed:18593899). Core component of the UV-DDB complex (UV-damaged DNA-binding protein complex), a complex that recognizes UV-induced DNA damage and recruit proteins of the nucleotide excision repair pathway (the NER pathway) to initiate DNA repair (PubMed:10882109, PubMed:11278856, PubMed:11705987, PubMed:16260596, PubMed:12944386, PubMed:14751237). The UV-DDB complex preferentially binds to cyclobutane pyrimidine dimers (CPD), 6-4 photoproducts (6-4 PP), apurinic sites and short mismatches (PubMed:10882109, PubMed:11278856, PubMed:11705987, PubMed:16260596, PubMed:12944386). Also functions as the substrate recognition module for the DCX (DDB2-CUL4-X-box) E3 ubiquitin-protein ligase complex DDB2-CUL4-ROC1 (also known as CUL4-DDB-ROC1 and CUL4-DDB-RBX1) (PubMed:12732143, PubMed:15882621, PubMed:16473935, PubMed:18593899, PubMed:26572825). The DDB2-CUL4-ROC1 complex may ubiquitinate histone H2A, histone H3 and histone H4 at sites of UV-induced DNA damage (PubMed:16678110, PubMed:16473935). The ubiquitination of histones may facilitate their removal from the nucleosome and promote subsequent DNA repair (PubMed:16678110, PubMed:16473935). The DDB2-CUL4-ROC1 complex also ubiquitinates XPC, which may enhance DNA-binding by XPC and promote NER (PubMed:15882621). The DDB2-CUL4-ROC1 complex also ubiquitinates KAT7/HBO1 in response to DNA damage, leading to its degradation: recognizes KAT7/HBO1 following phosphorylation by ATR (PubMed:26572825). {ECO:0000269|PubMed:10882109, ECO:0000269|PubMed:11278856, ECO:0000269|PubMed:11705987, ECO:0000269|PubMed:12732143, ECO:0000269|PubMed:12944386, ECO:0000269|PubMed:14751237, ECO:0000269|PubMed:15882621, ECO:0000269|PubMed:16260596, ECO:0000269|PubMed:16473935, ECO:0000269|PubMed:16678110, ECO:0000269|PubMed:18593899, ECO:0000269|PubMed:26572825, ECO:0000269|PubMed:9892649}.; FUNCTION: [Isoform D1]: Inhibits UV-damaged DNA repair. {ECO:0000269|PubMed:14751237}.; FUNCTION: [Isoform D2]: Inhibits UV-damaged DNA repair. {ECO:0000269|PubMed:14751237}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000359187, ENST00000360553, ENST00000432566, ENST00000543376, ENST00000565885, | ENST00000378601, ENST00000256996, ENST00000378600, ENST00000378603, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 6 X 5 X 4=120 | 12 X 6 X 7=504 |
# samples | 6 | 11 | |
** MAII score | log2(6/120*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(11/504*10)=-2.19592020997526 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: GOLGA8A [Title/Abstract] AND DDB2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: GOLGA8A [Title/Abstract] AND DDB2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | GOLGA8A(34680033)-DDB2(47259387), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | GOLGA8A-DDB2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GOLGA8A-DDB2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GOLGA8A-DDB2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GOLGA8A-DDB2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GOLGA8A-DDB2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. GOLGA8A-DDB2 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. GOLGA8A-DDB2 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. GOLGA8A-DDB2 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | DDB2 | GO:0000209 | protein polyubiquitination | 12732143 |
Tgene | DDB2 | GO:0009411 | response to UV | 12732143 |
Tgene | DDB2 | GO:0035518 | histone H2A monoubiquitination | 22334663 |
Tgene | DDB2 | GO:0051865 | protein autoubiquitination | 12732143 |
Tgene | DDB2 | GO:0070914 | UV-damage excision repair | 22334663 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:34680033/chr11:47259387) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000359187 | GOLGA8A | chr15 | 34680033 | - | ENST00000378600 | DDB2 | chr11 | 47259387 | + | 861 | 233 | 26 | 493 | 155 |
ENST00000359187 | GOLGA8A | chr15 | 34680033 | - | ENST00000378603 | DDB2 | chr11 | 47259387 | + | 861 | 233 | 26 | 493 | 155 |
ENST00000359187 | GOLGA8A | chr15 | 34680033 | - | ENST00000256996 | DDB2 | chr11 | 47259387 | + | 861 | 233 | 26 | 493 | 155 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000359187 | ENST00000378600 | GOLGA8A | chr15 | 34680033 | - | DDB2 | chr11 | 47259387 | + | 0.01609363 | 0.9839064 |
ENST00000359187 | ENST00000378603 | GOLGA8A | chr15 | 34680033 | - | DDB2 | chr11 | 47259387 | + | 0.01609363 | 0.9839064 |
ENST00000359187 | ENST00000256996 | GOLGA8A | chr15 | 34680033 | - | DDB2 | chr11 | 47259387 | + | 0.01609363 | 0.9839064 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for GOLGA8A-DDB2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
GOLGA8A | chr15 | 34680033 | DDB2 | chr11 | 47259387 | 233 | 69 | ETAASGGCHSSEAAAWHPRYNLIVVG |
Top |
Potential FusionNeoAntigen Information of GOLGA8A-DDB2 in HLA I |
![]() |
GOLGA8A-DDB2_34680033_47259387.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B58:01 | HSSEAAAW | 0.998 | 0.9883 | 8 | 16 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:08 | EAAAWHPRY | 0.9975 | 0.8691 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:01 | EAAAWHPRY | 0.993 | 0.8069 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B15:02 | EAAAWHPRY | 0.9917 | 0.9226 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:05 | EAAAWHPRY | 0.8841 | 0.5404 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B38:01 | CHSSEAAAW | 0.8069 | 0.9964 | 7 | 16 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B38:02 | CHSSEAAAW | 0.7794 | 0.9956 | 7 | 16 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B44:03 | SEAAAWHPRY | 0.9995 | 0.9354 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B18:01 | SEAAAWHPRY | 0.9454 | 0.931 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C15:04 | AAAWHPRY | 0.9965 | 0.9475 | 12 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B15:31 | EAAAWHPRY | 0.9932 | 0.7657 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B15:21 | EAAAWHPRY | 0.9929 | 0.8995 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C15:04 | EAAAWHPRY | 0.239 | 0.9005 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C06:03 | EAAAWHPRY | 0.0056 | 0.9874 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C12:04 | EAAAWHPRY | 0.0055 | 0.9858 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C12:12 | EAAAWHPRY | 0.0042 | 0.9067 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B57:04 | HSSEAAAW | 0.999 | 0.9374 | 8 | 16 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B57:02 | HSSEAAAW | 0.9971 | 0.9816 | 8 | 16 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C15:09 | AAAWHPRY | 0.9965 | 0.9475 | 12 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C16:02 | AAAWHPRY | 0.9286 | 0.9929 | 12 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C16:04 | AAAWHPRY | 0.9131 | 0.9764 | 12 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C16:01 | AAAWHPRY | 0.8349 | 0.9825 | 12 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-A25:01 | EAAAWHPRY | 0.9951 | 0.91 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:77 | EAAAWHPRY | 0.993 | 0.8069 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:20 | EAAAWHPRY | 0.9915 | 0.8553 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:23 | EAAAWHPRY | 0.9906 | 0.8187 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:11 | EAAAWHPRY | 0.9895 | 0.9084 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:24 | EAAAWHPRY | 0.9666 | 0.894 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:30 | EAAAWHPRY | 0.9595 | 0.6966 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:17 | EAAAWHPRY | 0.9595 | 0.6966 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B15:13 | EAAAWHPRY | 0.9316 | 0.6668 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B38:05 | CHSSEAAAW | 0.8069 | 0.9964 | 7 | 16 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B15:08 | EAAAWHPRY | 0.7491 | 0.8536 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C03:02 | EAAAWHPRY | 0.7486 | 0.9584 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B15:11 | EAAAWHPRY | 0.7476 | 0.8375 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B35:43 | EAAAWHPRY | 0.6852 | 0.854 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B18:04 | EAAAWHPRY | 0.6562 | 0.9334 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B18:07 | EAAAWHPRY | 0.319 | 0.8959 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C15:09 | EAAAWHPRY | 0.239 | 0.9005 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C12:02 | EAAAWHPRY | 0.1809 | 0.9617 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C16:04 | EAAAWHPRY | 0.0671 | 0.9682 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C02:10 | EAAAWHPRY | 0.0341 | 0.9734 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C02:02 | EAAAWHPRY | 0.0341 | 0.9734 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-C12:03 | EAAAWHPRY | 0.0249 | 0.9692 | 11 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B44:07 | SEAAAWHPRY | 0.9995 | 0.9354 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B44:13 | SEAAAWHPRY | 0.9995 | 0.9354 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B44:26 | SEAAAWHPRY | 0.9995 | 0.9354 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B18:11 | SEAAAWHPRY | 0.9609 | 0.8335 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B18:05 | SEAAAWHPRY | 0.9454 | 0.931 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B18:08 | SEAAAWHPRY | 0.9441 | 0.7055 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B15:53 | SEAAAWHPRY | 0.9413 | 0.8604 | 10 | 20 |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 | HLA-B18:06 | SEAAAWHPRY | 0.9408 | 0.9301 | 10 | 20 |
Top |
Potential FusionNeoAntigen Information of GOLGA8A-DDB2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of GOLGA8A-DDB2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2687 | GCHSSEAAAWHPRY | GOLGA8A | DDB2 | chr15 | 34680033 | chr11 | 47259387 | 233 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GOLGA8A-DDB2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2687 | GCHSSEAAAWHPRY | -6.15238 | -6.26578 |
HLA-B14:02 | 3BVN | 2687 | GCHSSEAAAWHPRY | -5.35203 | -6.38733 |
HLA-B52:01 | 3W39 | 2687 | GCHSSEAAAWHPRY | -5.804 | -6.8393 |
HLA-B52:01 | 3W39 | 2687 | GCHSSEAAAWHPRY | -5.45277 | -5.56617 |
HLA-A11:01 | 4UQ2 | 2687 | GCHSSEAAAWHPRY | -8.28119 | -9.31649 |
HLA-A24:02 | 5HGA | 2687 | GCHSSEAAAWHPRY | -9.93626 | -10.0497 |
HLA-A24:02 | 5HGA | 2687 | GCHSSEAAAWHPRY | -5.67154 | -6.70684 |
HLA-B27:05 | 6PYJ | 2687 | GCHSSEAAAWHPRY | -4.30966 | -5.34496 |
HLA-B44:05 | 3DX8 | 2687 | GCHSSEAAAWHPRY | -7.17842 | -7.29182 |
HLA-B44:05 | 3DX8 | 2687 | GCHSSEAAAWHPRY | -4.14208 | -5.17738 |
HLA-A02:01 | 6TDR | 2687 | GCHSSEAAAWHPRY | -5.17192 | -5.28532 |
Top |
Vaccine Design for the FusionNeoAntigens of GOLGA8A-DDB2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 10 | 20 | SEAAAWHPRY | TCTGAGGCTGCAGCCTGGCATCCTCGCTAC |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 11 | 20 | EAAAWHPRY | GAGGCTGCAGCCTGGCATCCTCGCTAC |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 12 | 20 | AAAWHPRY | GCTGCAGCCTGGCATCCTCGCTAC |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 7 | 16 | CHSSEAAAW | TGCCACTCATCTGAGGCTGCAGCCTGG |
GOLGA8A-DDB2 | chr15 | 34680033 | chr11 | 47259387 | 8 | 16 | HSSEAAAW | CACTCATCTGAGGCTGCAGCCTGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of GOLGA8A-DDB2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
ESCA | GOLGA8A-DDB2 | chr15 | 34680033 | ENST00000359187 | chr11 | 47259387 | ENST00000256996 | TCGA-L5-A8NM |
Top |
Potential target of CAR-T therapy development for GOLGA8A-DDB2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to GOLGA8A-DDB2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to GOLGA8A-DDB2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |