Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GOT1-CEBPZ

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GOT1-CEBPZ
	FusionPDB ID: 34041
	FusionGDB2.0 ID: 34041
		Hgene	Tgene
	Gene symbol	GOT1	CEBPZ
	Gene ID	127845	10153
	Gene name	golgi transport 1A	CCAAT enhancer binding protein zeta
	Synonyms	CGI-141\|GOT1\|HMFN1187\|YMR292W\|hGOT1b	CBF\|CBF2\|HSP-CBF\|NOC1
	Cytomap	1q32.1	2p22.2
	Type of gene	protein-coding	protein-coding
	Description	vesicle transport protein GOT1A	CCAAT/enhancer-binding protein zetaCCAAT-box-binding transcription factorCCAAT/enhancer binding protein (C/EBP), zetaCCAAT/enhancer binding protein cebp family zeta
	Modification date	20200313	20200313
	UniProtAcc	P17174 Main function of 5'-partner protein: FUNCTION: Biosynthesis of L-glutamate from L-aspartate or L-cysteine. Important regulator of levels of glutamate, the major excitatory neurotransmitter of the vertebrate central nervous system. Acts as a scavenger of glutamate in brain neuroprotection. The aspartate aminotransferase activity is involved in hepatic glucose synthesis during development and in adipocyte glyceroneogenesis. Using L-cysteine as substrate, regulates levels of mercaptopyruvate, an important source of hydrogen sulfide. Mercaptopyruvate is converted into H(2)S via the action of 3-mercaptopyruvate sulfurtransferase (3MST). Hydrogen sulfide is an important synaptic modulator and neuroprotectant in the brain. {ECO:0000269\|PubMed:16039064}.	A8MTT3 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000471741, ENST00000370508, ENST00000543866,	ENST00000234170,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 3 X 2=18	7 X 8 X 6=336
	# samples	3	10
	** MAII score	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(10/336*10)=-1.74846123300404 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GOT1 [Title/Abstract] AND CEBPZ [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GOT1 [Title/Abstract] AND CEBPZ [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GOT1(101190205)-CEBPZ(37444180), # samples:1
Anticipated loss of major functional domain due to fusion event.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	CEBPZ	GO:0045944	positive regulation of transcription by RNA polymerase II	2247079

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:101190205/chr2:37444180)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GOT1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CEBPZ (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000370508

GOT1

chr10

101190205

ENST00000234170

CEBPZ

chr2

37444180

1309

146

1156

382

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000370508	ENST00000234170	GOT1	chr10	101190205	-	CEBPZ	chr2	37444180	-	0.000236587	0.9997634

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GOT1-CEBPZ

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GOT1	chr10	101190205	CEBPZ	chr2	37444180	146	46	RIRTPARSTWEWELSVHFHPSVALFA

Top

Potential FusionNeoAntigen Information of GOT1-CEBPZ in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GOT1-CEBPZ_101190205_37444180.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:01	WEWELSVH	0.9993	0.9115	9	17
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:01	EWELSVHF	0.9784	0.9347	10	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:04	ARSTWEWEL	0.9992	0.8987	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:02	ARSTWEWEL	0.9992	0.7569	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:07	ARSTWEWEL	0.999	0.7824	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:01	WEWELSVHF	0.999	0.905	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:05	ARSTWEWEL	0.999	0.9117	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:24	ARSTWEWEL	0.9974	0.7432	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:06	ARSTWEWEL	0.9964	0.9594	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:01	ARSTWEWEL	0.9951	0.9517	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B13:01	WEWELSVHF	0.9941	0.9186	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:03	WEWELSVHF	0.9919	0.9695	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B38:01	ARSTWEWEL	0.9904	0.9887	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:38	STWEWELSV	0.9896	0.9024	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B38:02	ARSTWEWEL	0.9885	0.9875	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:21	STWEWELSV	0.9843	0.906	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:35	STWEWELSV	0.9835	0.8839	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B14:02	ARSTWEWEL	0.9818	0.9596	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B14:01	ARSTWEWEL	0.9818	0.9596	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:20	STWEWELSV	0.9817	0.8762	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:29	STWEWELSV	0.9791	0.8656	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:11	STWEWELSV	0.9754	0.8766	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:60	STWEWELSV	0.9735	0.8499	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:24	STWEWELSV	0.9709	0.868	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:67	STWEWELSV	0.9709	0.868	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:30	STWEWELSV	0.9709	0.868	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:04	STWEWELSV	0.9655	0.8427	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:27	STWEWELSV	0.961	0.8822	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:16	STWEWELSV	0.9606	0.8061	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:17	STWEWELSV	0.9493	0.7231	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:13	STWEWELSV	0.9459	0.9221	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:19	STWEWELSV	0.8784	0.8021	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B13:02	STWEWELSV	0.558	0.9768	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:13	WEWELSVHF	0.5427	0.9326	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A32:13	STWEWELSV	0.4198	0.9874	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B52:01	STWEWELSV	0.2322	0.9987	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B07:10	ARSTWEWEL	0.0075	0.6379	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B47:01	TWEWELSVHF	0.953	0.5776	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:03	TWEWELSVHF	0.9171	0.9825	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A24:14	TWEWELSVHF	0.9117	0.6103	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:01	TWEWELSVHF	0.8531	0.9075	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:20	RSTWEWELSV	0.7707	0.858	6	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:07	ARSTWEWELSV	0.9999	0.8603	5	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B57:03	STWEWELSVHF	0.9997	0.9956	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A32:13	STWEWELSVHF	0.9891	0.9387	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:03	STWEWELSVHF	0.9324	0.9699	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B47:01	STWEWELSVHF	0.9314	0.5823	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C15:06	STWEWELSV	0.9994	0.9849	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:14	ARSTWEWEL	0.9991	0.9087	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C15:04	STWEWELSV	0.9988	0.9818	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C04:06	STWEWELSV	0.9988	0.9737	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:95	ARSTWEWEL	0.9968	0.8758	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:09	ARSTWEWEL	0.9959	0.904	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B40:06	WEWELSVHF	0.9957	0.5545	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:05	ARSTWEWEL	0.9949	0.9742	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:12	ARSTWEWEL	0.9947	0.9529	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:27	ARSTWEWEL	0.9904	0.9772	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:29	ARSTWEWEL	0.988	0.9471	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:05	STWEWELSV	0.9861	0.7188	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:13	ARSTWEWEL	0.9829	0.9674	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:07	STWEWELSV	0.9721	0.8745	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:01	STWEWELSV	0.9709	0.868	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:03	ARSTWEWEL	0.9669	0.9285	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:05	ARSTWEWEL	0.9419	0.9418	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C12:04	STWEWELSV	0.9302	0.9975	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C06:03	STWEWELSV	0.9217	0.9975	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:46	ARSTWEWEL	0.8118	0.9503	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:19	ARSTWEWEL	0.8053	0.8994	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:80	ARSTWEWEL	0.8025	0.9769	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:67	ARSTWEWEL	0.8025	0.9769	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:10	ARSTWEWEL	0.8006	0.9819	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:08	WEWELSVHF	0.3787	0.877	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B51:07	WEWELSVHF	0.1785	0.7934	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C12:16	ARSTWEWEL	0.0176	0.9737	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:14	ARSTWEWELSV	1	0.8973	5	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:03	ARSTWEWELSV	0.9986	0.8898	5	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B40:03	STWEWELSVHF	0.9773	0.522	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:05	WEWELSVH	0.9993	0.9115	9	17
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:06	WEWELSVH	0.9993	0.9204	9	17
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:11	WEWELSVH	0.992	0.9416	9	17
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:05	EWELSVHF	0.9784	0.9347	10	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C15:02	STWEWELSV	0.9996	0.973	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C15:05	STWEWELSV	0.9995	0.971	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:04	WEWELSVHF	0.9992	0.9187	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:10	ARSTWEWEL	0.9991	0.9369	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:06	ARSTWEWEL	0.9991	0.8993	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:06	WEWELSVHF	0.9991	0.912	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:08	ARSTWEWEL	0.9991	0.8855	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:05	WEWELSVHF	0.999	0.905	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:07	WEWELSVHF	0.999	0.8537	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:08	WEWELSVHF	0.9989	0.7779	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C15:09	STWEWELSV	0.9988	0.9818	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:09	ARSTWEWEL	0.9987	0.9249	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:03	WEWELSVHF	0.9982	0.8941	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A68:02	STWEWELSV	0.9969	0.9464	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:01	ARSTWEWEL	0.9968	0.8586	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B40:04	WEWELSVHF	0.9954	0.7162	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:31	ARSTWEWEL	0.9951	0.9525	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A69:01	STWEWELSV	0.9938	0.9604	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:26	WEWELSVHF	0.9919	0.9695	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:07	WEWELSVHF	0.9919	0.9695	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:13	WEWELSVHF	0.9919	0.9695	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B38:05	ARSTWEWEL	0.9904	0.9887	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:14	STWEWELSV	0.9844	0.8712	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A02:06	STWEWELSV	0.9843	0.906	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C16:02	STWEWELSV	0.9802	0.9967	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:11	WEWELSVHF	0.975	0.9295	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:17	ARSTWEWEL	0.9732	0.9773	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C06:08	ARSTWEWEL	0.9033	0.9964	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B35:20	WEWELSVHF	0.883	0.9304	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:04	ARSTWEWEL	0.8278	0.9088	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B35:28	WEWELSVHF	0.8077	0.9105	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:02	ARSTWEWEL	0.8025	0.9769	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A32:01	STWEWELSV	0.7923	0.9861	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C17:01	STWEWELSV	0.766	0.9896	7	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C07:22	ARSTWEWEL	0.7363	0.8081	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B48:02	WEWELSVHF	0.6267	0.8899	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:11	ARSTWEWEL	0.6237	0.8911	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B39:02	WEWELSVHF	0.584	0.9286	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B15:53	WEWELSVHF	0.5288	0.8036	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C06:06	ARSTWEWEL	0.382	0.9943	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B41:03	WEWELSVHF	0.3647	0.6955	9	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C06:17	ARSTWEWEL	0.0342	0.9967	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-C06:02	ARSTWEWEL	0.0342	0.9967	5	14
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:11	TWEWELSVHF	0.9244	0.9461	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:07	TWEWELSVHF	0.9171	0.9825	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:13	TWEWELSVHF	0.9171	0.9825	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:26	TWEWELSVHF	0.9171	0.9825	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:08	TWEWELSVHF	0.8679	0.8303	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:05	TWEWELSVHF	0.8531	0.9075	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:03	TWEWELSVHF	0.8451	0.8987	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B40:04	TWEWELSVHF	0.7985	0.7603	8	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:08	ARSTWEWELSV	1	0.8455	5	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B27:09	ARSTWEWELSV	0.9999	0.8724	5	16
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-A32:01	STWEWELSVHF	0.9953	0.9309	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B18:11	STWEWELSVHF	0.9772	0.935	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:13	STWEWELSVHF	0.9324	0.9699	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:07	STWEWELSVHF	0.9324	0.9699	7	18
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	HLA-B44:26	STWEWELSVHF	0.9324	0.9699	7	18

Top

Potential FusionNeoAntigen Information of GOT1-CEBPZ in HLA II

GOT1-CEBPZ_101190205_37444180.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GOT1-CEBPZ	chr10	101190205	chr2	37444180	146	DRB1-1510	WELSVHFHPSVALFA	11	26

Top

Fusion breakpoint peptide structures of GOT1-CEBPZ

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8256	RSTWEWELSVHFHP	GOT1	CEBPZ	chr10	101190205	chr2	37444180	146

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GOT1-CEBPZ

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8256	RSTWEWELSVHFHP	-6.80686	-6.92026
HLA-B14:02	3BVN	8256	RSTWEWELSVHFHP	-5.01234	-6.04764
HLA-B52:01	3W39	8256	RSTWEWELSVHFHP	-6.71251	-6.82591
HLA-B52:01	3W39	8256	RSTWEWELSVHFHP	-4.13165	-5.16695
HLA-A11:01	4UQ2	8256	RSTWEWELSVHFHP	-4.31699	-4.43039
HLA-A11:01	4UQ2	8256	RSTWEWELSVHFHP	-4.19959	-5.23489
HLA-A24:02	5HGA	8256	RSTWEWELSVHFHP	-7.74913	-7.86253
HLA-A24:02	5HGA	8256	RSTWEWELSVHFHP	-5.75888	-6.79418
HLA-B27:03	6PZ5	8256	RSTWEWELSVHFHP	10001	10000
HLA-B44:05	3DX8	8256	RSTWEWELSVHFHP	-4.89721	-5.01061
HLA-B44:05	3DX8	8256	RSTWEWELSVHFHP	-3.74482	-4.78012
HLA-A02:01	6TDR	8256	RSTWEWELSVHFHP	-5.01451	-6.04981

Top

Vaccine Design for the FusionNeoAntigens of GOT1-CEBPZ

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GOT1-CEBPZ	chr10	101190205	chr2	37444180	10	18	EWELSVHF	GAGTGGGAGTTATCTGTGCATTTT
GOT1-CEBPZ	chr10	101190205	chr2	37444180	5	14	ARSTWEWEL	GCAAGGTCAACCTGGGAGTGGGAGTTA
GOT1-CEBPZ	chr10	101190205	chr2	37444180	5	16	ARSTWEWELSV	GCAAGGTCAACCTGGGAGTGGGAGTTATCTGTG
GOT1-CEBPZ	chr10	101190205	chr2	37444180	6	16	RSTWEWELSV	AGGTCAACCTGGGAGTGGGAGTTATCTGTG
GOT1-CEBPZ	chr10	101190205	chr2	37444180	7	16	STWEWELSV	TCAACCTGGGAGTGGGAGTTATCTGTG
GOT1-CEBPZ	chr10	101190205	chr2	37444180	7	18	STWEWELSVHF	TCAACCTGGGAGTGGGAGTTATCTGTGCATTTT
GOT1-CEBPZ	chr10	101190205	chr2	37444180	8	18	TWEWELSVHF	ACCTGGGAGTGGGAGTTATCTGTGCATTTT
GOT1-CEBPZ	chr10	101190205	chr2	37444180	9	17	WEWELSVH	TGGGAGTGGGAGTTATCTGTGCAT
GOT1-CEBPZ	chr10	101190205	chr2	37444180	9	18	WEWELSVHF	TGGGAGTGGGAGTTATCTGTGCATTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
GOT1-CEBPZ	chr10	101190205	chr2	37444180	11	26	WELSVHFHPSVALFA	TGGGAGTTATCTGTGCATTTTCATCCCTCCGTGGCCCTTTTTGCA

Top

Information of the samples that have these potential fusion neoantigens of GOT1-CEBPZ

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	GOT1-CEBPZ	chr10	101190205	ENST00000370508	chr2	37444180	ENST00000234170	TCGA-BR-8059-01A

Top

Potential target of CAR-T therapy development for GOT1-CEBPZ

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GOT1-CEBPZ

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GOT1-CEBPZ

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)