|
|||||||
|
Fusion Protein:HMGB1-CCNA1 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: HMGB1-CCNA1 | FusionPDB ID: 36863 | FusionGDB2.0 ID: 36863 | Hgene | Tgene | Gene symbol | HMGB1 | CCNA1 | Gene ID | 3146 | 8900 |
| Gene name | high mobility group box 1 | cyclin A1 | |
| Synonyms | HMG-1|HMG1|HMG3|SBP-1 | CT146 | |
| Cytomap | 13q12.3 | 13q13.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | high mobility group protein B1AmphoterinSulfoglucuronyl carbohydrate binding proteinhigh-mobility group (nonhistone chromosomal) protein 1 | cyclin-A1testicular tissue protein Li 34 | |
| Modification date | 20200329 | 20200313 | |
| UniProtAcc | P09429 Main function of 5'-partner protein: FUNCTION: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability (Ref.71). Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury (PubMed:27362237). Released to the extracellular environment can bind DNA, nucleosomes, IL-1 beta, CXCL12, AGER isoform 2/sRAGE, lipopolysaccharide (LPS) and lipoteichoic acid (LTA), and activates cells through engagement of multiple surface receptors. In the extracellular compartment fully reduced HMGB1 (released by necrosis) acts as a chemokine, disulfide HMGB1 (actively secreted) as a cytokine, and sulfonyl HMGB1 (released from apoptotic cells) promotes immunological tolerance (PubMed:23519706, PubMed:23446148, PubMed:23994764, PubMed:25048472). Has proangiogdenic activity (By similarity). May be involved in platelet activation (By similarity). Binds to phosphatidylserine and phosphatidylethanolamide (By similarity). Bound to RAGE mediates signaling for neuronal outgrowth (By similarity). May play a role in accumulation of expanded polyglutamine (polyQ) proteins such as huntingtin (HTT) or TBP (PubMed:23303669, PubMed:25549101). {ECO:0000250|UniProtKB:P10103, ECO:0000250|UniProtKB:P12682, ECO:0000250|UniProtKB:P63158, ECO:0000250|UniProtKB:P63159, ECO:0000269|PubMed:23303669, ECO:0000269|PubMed:25549101, ECO:0000269|PubMed:27362237, ECO:0000269|Ref.71, ECO:0000305|PubMed:23446148, ECO:0000305|PubMed:23519706, ECO:0000305|PubMed:23994764, ECO:0000305|PubMed:25048472}.; FUNCTION: Nuclear functions are attributed to fully reduced HGMB1. Associates with chromatin and binds DNA with a preference to non-canonical DNA structures such as single-stranded DNA, DNA-containing cruciforms or bent structures, supercoiled DNA and ZDNA. Can bent DNA and enhance DNA flexibility by looping thus providing a mechanism to promote activities on various gene promoters by enhancing transcription factor binding and/or bringing distant regulatory sequences into close proximity (PubMed:20123072). May have an enhancing role in nucleotide excision repair (NER) (By similarity). However, effects in NER using in vitro systems have been reported conflictingly (PubMed:19446504, PubMed:19360789). May be involved in mismatch repair (MMR) and base excision repair (BER) pathways (PubMed:15014079, PubMed:16143102, PubMed:17803946). May be involved in double strand break repair such as non-homologous end joining (NHEJ) (By similarity). Involved in V(D)J recombination by acting as a cofactor of the RAG complex: acts by stimulating cleavage and RAG protein binding at the 23 bp spacer of conserved recombination signal sequences (RSS) (By similarity). In vitro can displace histone H1 from highly bent DNA (By similarity). Can restructure the canonical nucleosome leading to relaxation of structural constraints for transcription factor-binding (By similarity). Enhances binding of sterol regulatory element-binding proteins (SREBPs) such as SREBF1 to their cognate DNA sequences and increases their transcriptional activities (By similarity). Facilitates binding of TP53 to DNA (PubMed:23063560). Proposed to be involved in mitochondrial quality control and autophagy in a transcription-dependent fashion implicating HSPB1; however, this function has been questioned (By similarity). Can modulate the activity of the telomerase complex and may be involved in telomere maintenance (By similarity). {ECO:0000250|UniProtKB:P10103, ECO:0000250|UniProtKB:P63158, ECO:0000250|UniProtKB:P63159, ECO:0000269|PubMed:15014079, ECO:0000269|PubMed:16143102, ECO:0000269|PubMed:17803946, ECO:0000269|PubMed:19446504, ECO:0000269|PubMed:23063560, ECO:0000305|PubMed:19360789, ECO:0000305|PubMed:20123072}.; FUNCTION: In the cytoplasm proposed to dissociate the BECN1:BCL2 complex via competitive interaction with BECN1 leading to autophagy activation (PubMed:20819940). Involved in oxidative stress-mediated autophagy (PubMed:21395369). Can protect BECN1 and ATG5 from calpain-mediated cleavage and thus proposed to control their proautophagic and proapoptotic functions and to regulate the extent and severity of inflammation-associated cellular injury (By similarity). In myeloid cells has a protective role against endotoxemia and bacterial infection by promoting autophagy (By similarity). Involved in endosomal translocation and activation of TLR9 in response to CpG-DNA in macrophages (By similarity). {ECO:0000250|UniProtKB:P63158, ECO:0000269|PubMed:20819940, ECO:0000269|PubMed:21395369}.; FUNCTION: In the extracellular compartment (following either active secretion or passive release) involved in regulation of the inflammatory response. Fully reduced HGMB1 (which subsequently gets oxidized after release) in association with CXCL12 mediates the recruitment of inflammatory cells during the initial phase of tissue injury; the CXCL12:HMGB1 complex triggers CXCR4 homodimerization (PubMed:22370717). Induces the migration of monocyte-derived immature dendritic cells and seems to regulate adhesive and migratory functions of neutrophils implicating AGER/RAGE and ITGAM (By similarity). Can bind to various types of DNA and RNA including microbial unmethylated CpG-DNA to enhance the innate immune response to nucleic acids. Proposed to act in promiscuous DNA/RNA sensing which cooperates with subsequent discriminative sensing by specific pattern recognition receptors (By similarity). Promotes extracellular DNA-induced AIM2 inflammasome activation implicating AGER/RAGE (PubMed:24971542). Disulfide HMGB1 binds to transmembrane receptors, such as AGER/RAGE, TLR2, TLR4 and probably TREM1, thus activating their signal transduction pathways. Mediates the release of cytokines/chemokines such as TNF, IL-1, IL-6, IL-8, CCL2, CCL3, CCL4 and CXCL10 (PubMed:12765338, PubMed:18354232, PubMed:19264983, PubMed:20547845, PubMed:24474694). Promotes secretion of interferon-gamma by macrophage-stimulated natural killer (NK) cells in concert with other cytokines like IL-2 or IL-12 (PubMed:15607795). TLR4 is proposed to be the primary receptor promoting macrophage activation and signaling through TLR4 seems to implicate LY96/MD-2 (PubMed:20547845). In bacterial LPS- or LTA-mediated inflammatory responses binds to the endotoxins and transfers them to CD14 for signaling to the respective TLR4:LY96 and TLR2 complexes (PubMed:18354232, PubMed:21660935, PubMed:25660311). Contributes to tumor proliferation by association with ACER/RAGE (By similarity). Can bind to IL1-beta and signals through the IL1R1:IL1RAP receptor complex (PubMed:18250463). Binding to class A CpG activates cytokine production in plasmacytoid dendritic cells implicating TLR9, MYD88 and AGER/RAGE and can activate autoreactive B cells. Via HMGB1-containing chromatin immune complexes may also promote B cell responses to endogenous TLR9 ligands through a B-cell receptor (BCR)-dependent and ACER/RAGE-independent mechanism (By similarity). Inhibits phagocytosis of apoptotic cells by macrophages; the function is dependent on poly-ADP-ribosylation and involves binding to phosphatidylserine on the cell surface of apoptotic cells (By similarity). In adaptive immunity may be involved in enhancing immunity through activation of effector T cells and suppression of regulatory T (TReg) cells (PubMed:15944249, PubMed:22473704). In contrast, without implicating effector or regulatory T-cells, required for tumor infiltration and activation of T-cells expressing the lymphotoxin LTA:LTB heterotrimer thus promoting tumor malignant progression (By similarity). Also reported to limit proliferation of T-cells (By similarity). Released HMGB1:nucleosome complexes formed during apoptosis can signal through TLR2 to induce cytokine production (PubMed:19064698). Involved in induction of immunological tolerance by apoptotic cells; its pro-inflammatory activities when released by apoptotic cells are neutralized by reactive oxygen species (ROS)-dependent oxidation specifically on Cys-106 (PubMed:18631454). During macrophage activation by activated lymphocyte-derived self apoptotic DNA (ALD-DNA) promotes recruitment of ALD-DNA to endosomes (By similarity). {ECO:0000250|UniProtKB:P10103, ECO:0000250|UniProtKB:P63158, ECO:0000250|UniProtKB:P63159, ECO:0000269|PubMed:12765338, ECO:0000269|PubMed:15607795, ECO:0000269|PubMed:15944249, ECO:0000269|PubMed:18250463, ECO:0000269|PubMed:18354232, ECO:0000269|PubMed:18631454, ECO:0000269|PubMed:19064698, ECO:0000269|PubMed:19264983, ECO:0000269|PubMed:20547845, ECO:0000269|PubMed:21660935, ECO:0000269|PubMed:22370717, ECO:0000269|PubMed:22473704, ECO:0000269|PubMed:24474694, ECO:0000269|PubMed:24971542, ECO:0000269|PubMed:25660311, ECO:0000269|Ref.8}.; FUNCTION: (Microbial infection) Critical for entry of human coronaviruses SARS-CoV and SARS-CoV-2, as well as human coronavirus NL63/HCoV-NL63. Regulates the expression of the pro-viral genes ACE2 and CTSL through chromatin modulation. {ECO:0000269|Ref.71}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000326004, ENST00000339872, ENST00000341423, ENST00000399489, ENST00000399494, ENST00000405805, ENST00000468384, | ENST00000255465, ENST00000418263, ENST00000463403, ENST00000440264, ENST00000449823, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 11 X 14 X 4=616 | 3 X 6 X 3=54 |
| # samples | 14 | 4 | |
| ** MAII score | log2(14/616*10)=-2.13750352374993 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/54*10)=-0.432959407276106 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: HMGB1 [Title/Abstract] AND CCNA1 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: HMGB1 [Title/Abstract] AND CCNA1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HMGB1(31036675)-CCNA1(37011766), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | HMGB1-CCNA1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HMGB1-CCNA1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HMGB1-CCNA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HMGB1-CCNA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HMGB1-CCNA1 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. HMGB1-CCNA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | HMGB1 | GO:0002218 | activation of innate immune response | 24971542 |
| Hgene | HMGB1 | GO:0002643 | regulation of tolerance induction | 18631454 |
| Hgene | HMGB1 | GO:0006357 | regulation of transcription by RNA polymerase II | 11748232 |
| Hgene | HMGB1 | GO:0006954 | inflammatory response | 23146691 |
| Hgene | HMGB1 | GO:0007204 | positive regulation of cytosolic calcium ion concentration | 22370717 |
| Hgene | HMGB1 | GO:0017055 | negative regulation of RNA polymerase II transcriptional preinitiation complex assembly | 8006019 |
| Hgene | HMGB1 | GO:0032072 | regulation of restriction endodeoxyribonuclease activity | 17803946 |
| Hgene | HMGB1 | GO:0032425 | positive regulation of mismatch repair | 15014079 |
| Hgene | HMGB1 | GO:0032689 | negative regulation of interferon-gamma production | 22473704 |
| Hgene | HMGB1 | GO:0032733 | positive regulation of interleukin-10 production | 22473704 |
| Hgene | HMGB1 | GO:0032755 | positive regulation of interleukin-6 production | 26961863 |
| Hgene | HMGB1 | GO:0032757 | positive regulation of interleukin-8 production | 26961863 |
| Hgene | HMGB1 | GO:0033151 | V(D)J recombination | 9166431 |
| Hgene | HMGB1 | GO:0035711 | T-helper 1 cell activation | 22473704 |
| Hgene | HMGB1 | GO:0043065 | positive regulation of apoptotic process | 19800306 |
| Hgene | HMGB1 | GO:0043277 | apoptotic cell clearance | 18768881 |
| Hgene | HMGB1 | GO:0043280 | positive regulation of cysteine-type endopeptidase activity involved in apoptotic process | 19800306 |
| Hgene | HMGB1 | GO:0043371 | negative regulation of CD4-positive, alpha-beta T cell differentiation | 22473704 |
| Hgene | HMGB1 | GO:0043388 | positive regulation of DNA binding | 11748232|19223331 |
| Hgene | HMGB1 | GO:0043410 | positive regulation of MAPK cascade | 12765338 |
| Hgene | HMGB1 | GO:0043537 | negative regulation of blood vessel endothelial cell migration | 23148224 |
| Hgene | HMGB1 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 19223331 |
| Hgene | HMGB1 | GO:0046330 | positive regulation of JNK cascade | 12765338 |
| Hgene | HMGB1 | GO:0050716 | positive regulation of interleukin-1 secretion | 12765338 |
| Hgene | HMGB1 | GO:0070374 | positive regulation of ERK1 and ERK2 cascade | 22370717 |
| Hgene | HMGB1 | GO:0090026 | positive regulation of monocyte chemotaxis | 22370717 |
| Hgene | HMGB1 | GO:0097350 | neutrophil clearance | 18768881 |
| Hgene | HMGB1 | GO:1990774 | tumor necrosis factor secretion | 12765338 |
| Hgene | HMGB1 | GO:2000343 | positive regulation of chemokine (C-X-C motif) ligand 2 production | 26961863 |
| Hgene | HMGB1 | GO:2000426 | negative regulation of apoptotic cell clearance | 20826760 |
| Hgene | HMGB1 | GO:2000778 | positive regulation of interleukin-6 secretion | 12765338 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr13:31036675/chr13:37011766) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across HMGB1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across CCNA1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000405805 | HMGB1 | chr13 | 31036675 | - | ENST00000449823 | CCNA1 | chr13 | 37011766 | + | 2730 | 1412 | 941 | 2512 | 523 |
| ENST00000405805 | HMGB1 | chr13 | 31036675 | - | ENST00000440264 | CCNA1 | chr13 | 37011766 | + | 2730 | 1412 | 941 | 2512 | 523 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000405805 | ENST00000449823 | HMGB1 | chr13 | 31036675 | - | CCNA1 | chr13 | 37011766 | + | 0.000699164 | 0.99930084 |
| ENST00000405805 | ENST00000440264 | HMGB1 | chr13 | 31036675 | - | CCNA1 | chr13 | 37011766 | + | 0.000699164 | 0.99930084 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HMGB1-CCNA1 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| HMGB1 | chr13 | 31036675 | CCNA1 | chr13 | 37011766 | 1412 | 157 | EKKAAKLKEKYEKGITRIRCYSGSEN |
Top |
Potential FusionNeoAntigen Information of HMGB1-CCNA1 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| HMGB1-CCNA1_31036675_37011766.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B52:01 | YEKGITRI | 0.9007 | 0.644 | 10 | 18 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B44:03 | YEKGITRIRCY | 0.9969 | 0.7008 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B18:01 | YEKGITRIRCY | 0.991 | 0.7147 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-C04:07 | KYEKGITRI | 0.9047 | 0.6492 | 9 | 18 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-C04:10 | KYEKGITRI | 0.8953 | 0.6383 | 9 | 18 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-C04:14 | KYEKGITRI | 0.4762 | 0.6795 | 9 | 18 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-C18:01 | KYEKGITRI | 0.9138 | 0.6402 | 9 | 18 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-C04:01 | KYEKGITRI | 0.9047 | 0.6492 | 9 | 18 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-C06:06 | KYEKGITRI | 0.4412 | 0.9067 | 9 | 18 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-C04:04 | KYEKGITRI | 0.2613 | 0.6936 | 9 | 18 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B44:07 | YEKGITRIRCY | 0.9969 | 0.7008 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B44:13 | YEKGITRIRCY | 0.9969 | 0.7008 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B44:26 | YEKGITRIRCY | 0.9969 | 0.7008 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B18:11 | YEKGITRIRCY | 0.9932 | 0.6226 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B18:05 | YEKGITRIRCY | 0.991 | 0.7147 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B18:06 | YEKGITRIRCY | 0.9893 | 0.7037 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B18:03 | YEKGITRIRCY | 0.9893 | 0.6886 | 10 | 21 |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 | HLA-B15:53 | YEKGITRIRCY | 0.9667 | 0.6507 | 10 | 21 |
Top |
Potential FusionNeoAntigen Information of HMGB1-CCNA1 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of HMGB1-CCNA1 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 5152 | LKEKYEKGITRIRC | HMGB1 | CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 1412 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HMGB1-CCNA1 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 5152 | LKEKYEKGITRIRC | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 5152 | LKEKYEKGITRIRC | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 5152 | LKEKYEKGITRIRC | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 5152 | LKEKYEKGITRIRC | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 5152 | LKEKYEKGITRIRC | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 5152 | LKEKYEKGITRIRC | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 5152 | LKEKYEKGITRIRC | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 5152 | LKEKYEKGITRIRC | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 5152 | LKEKYEKGITRIRC | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 5152 | LKEKYEKGITRIRC | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 5152 | LKEKYEKGITRIRC | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of HMGB1-CCNA1 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 10 | 18 | YEKGITRI | TATGAAAAGGGGATCACAAGAATC |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 10 | 21 | YEKGITRIRCY | TATGAAAAGGGGATCACAAGAATCAGGTGTTAT |
| HMGB1-CCNA1 | chr13 | 31036675 | chr13 | 37011766 | 9 | 18 | KYEKGITRI | AAATATGAAAAGGGGATCACAAGAATC |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of HMGB1-CCNA1 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| SARC | HMGB1-CCNA1 | chr13 | 31036675 | ENST00000405805 | chr13 | 37011766 | ENST00000440264 | TCGA-KD-A5QS-01A |
Top |
Potential target of CAR-T therapy development for HMGB1-CCNA1 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HMGB1-CCNA1 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HMGB1-CCNA1 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies