![]() |
|||||||
|
Fusion Protein:HOOK3-BAALC |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: HOOK3-BAALC | FusionPDB ID: 37383 | FusionGDB2.0 ID: 37383 | Hgene | Tgene | Gene symbol | HOOK3 | BAALC | Gene ID | 84376 | 79870 |
Gene name | hook microtubule tethering protein 3 | BAALC binder of MAP3K1 and KLF4 | |
Synonyms | HK3 | - | |
Cytomap | 8p11.21 | 8q22.3 | |
Type of gene | protein-coding | protein-coding | |
Description | protein Hook homolog 3h-hook3hHK3hook homolog 3 | brain and acute leukemia cytoplasmic proteinBAALC, MAP3K1 and KLF4 bindingBAALC, MEKK1 and KLF4 bindingbrain and acute leukemia, cytoplasmic | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q86VS8 Main function of 5'-partner protein: FUNCTION: Probably serves as a target for the spiC protein from Salmonella typhimurium, which inactivates it, leading to a strong alteration in cellular trafficking (By similarity). Component of the FTS/Hook/FHIP complex (FHF complex). The FHF complex may function to promote vesicle trafficking and/or fusion via the homotypic vesicular protein sorting complex (the HOPS complex). May regulate clearance of endocytosed receptors such as MSR1. Participates in defining the architecture and localization of the Golgi complex. Acts as an adapter protein linking the dynein motor complex to various cargos and converts dynein from a non-processive to a highly processive motor in the presence of dynactin. Facilitates the interaction between dynein and dynactin and activates dynein processivity (the ability to move along a microtubule for a long distance without falling off the track) (PubMed:25035494). FHF complex promotes the distribution of AP-4 complex to the perinuclear area of the cell (PubMed:32073997). {ECO:0000250|UniProtKB:Q8BUK6, ECO:0000269|PubMed:11238449, ECO:0000269|PubMed:17237231, ECO:0000269|PubMed:18799622, ECO:0000269|PubMed:25035494, ECO:0000269|PubMed:32073997}.; FUNCTION: (Microbial infection) May serve as a target for the spiC protein from Salmonella typhimurium, which inactivates it, leading to a strong alteration in cellular trafficking. {ECO:0000305}. | Q8WXS3 Main function of 5'-partner protein: FUNCTION: May play a synaptic role at the postsynaptic lipid rafts possibly through interaction with CAMK2A. {ECO:0000250|UniProtKB:Q920K5}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000307602, ENST00000524839, | ENST00000523754, ENST00000297574, ENST00000306391, ENST00000330955, ENST00000438105, ENST00000309982, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 16 X 13 X 9=1872 | 6 X 2 X 4=48 |
# samples | 19 | 6 | |
** MAII score | log2(19/1872*10)=-3.30050911125246 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(6/48*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: HOOK3 [Title/Abstract] AND BAALC [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: HOOK3 [Title/Abstract] AND BAALC [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HOOK3(42780772)-BAALC(104225147), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | HOOK3-BAALC seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HOOK3-BAALC seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HOOK3-BAALC seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HOOK3-BAALC seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HOOK3-BAALC seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. HOOK3-BAALC seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:42780772/chr8:104225147) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000307602 | HOOK3 | chr8 | 42780772 | + | ENST00000309982 | BAALC | chr8 | 104240217 | + | 2732 | 416 | 182 | 526 | 114 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000307602 | ENST00000309982 | HOOK3 | chr8 | 42780772 | + | BAALC | chr8 | 104240217 | + | 0.007565367 | 0.9924346 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HOOK3-BAALC |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
HOOK3 | chr8 | 42780772 | BAALC | chr8 | 104240217 | 416 | 78 | RIKTEVGDNWRLKAKRDAKRMPAKEV |
Top |
Potential FusionNeoAntigen Information of HOOK3-BAALC in HLA I |
![]() |
HOOK3-BAALC_42780772_104240217.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | HLA-A30:08 | RLKAKRDAK | 0.9909 | 0.5805 | 10 | 19 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | HLA-A30:01 | RLKAKRDAK | 0.992 | 0.7615 | 10 | 19 |
Top |
Potential FusionNeoAntigen Information of HOOK3-BAALC in HLA II |
![]() |
HOOK3-BAALC_42780772_104240217.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1111 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1111 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1111 | EVGDNWRLKAKRDAK | 4 | 19 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1111 | DNWRLKAKRDAKRMP | 7 | 22 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1114 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1120 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1132 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1132 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1168 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1168 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1172 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1172 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1186 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1186 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1302 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1316 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1316 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1323 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1329 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1329 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1334 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1336 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1336 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1339 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1363 | VGDNWRLKAKRDAKR | 5 | 20 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1363 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1363 | EVGDNWRLKAKRDAK | 4 | 19 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1363 | DNWRLKAKRDAKRMP | 7 | 22 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1373 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1374 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1397 | GDNWRLKAKRDAKRM | 6 | 21 |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 | DRB1-1399 | GDNWRLKAKRDAKRM | 6 | 21 |
Top |
Fusion breakpoint peptide structures of HOOK3-BAALC |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2715 | GDNWRLKAKRDAKR | HOOK3 | BAALC | chr8 | 42780772 | chr8 | 104240217 | 416 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HOOK3-BAALC |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2715 | GDNWRLKAKRDAKR | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 2715 | GDNWRLKAKRDAKR | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 2715 | GDNWRLKAKRDAKR | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 2715 | GDNWRLKAKRDAKR | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 2715 | GDNWRLKAKRDAKR | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 2715 | GDNWRLKAKRDAKR | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 2715 | GDNWRLKAKRDAKR | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 2715 | GDNWRLKAKRDAKR | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 2715 | GDNWRLKAKRDAKR | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 2715 | GDNWRLKAKRDAKR | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 2715 | GDNWRLKAKRDAKR | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of HOOK3-BAALC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 10 | 19 | RLKAKRDAK | AGGCTAAAGGCTAAAAGAGATGCTAAG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 4 | 19 | EVGDNWRLKAKRDAK | GAAGTAGGAGATAATTGGAGGCTAAAGGCTAAAAGAGATGCTAAG |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 5 | 20 | VGDNWRLKAKRDAKR | GTAGGAGATAATTGGAGGCTAAAGGCTAAAAGAGATGCTAAGAGA |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 6 | 21 | GDNWRLKAKRDAKRM | GGAGATAATTGGAGGCTAAAGGCTAAAAGAGATGCTAAGAGAATG |
HOOK3-BAALC | chr8 | 42780772 | chr8 | 104240217 | 7 | 22 | DNWRLKAKRDAKRMP | GATAATTGGAGGCTAAAGGCTAAAAGAGATGCTAAGAGAATGCCT |
Top |
Information of the samples that have these potential fusion neoantigens of HOOK3-BAALC |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BLCA | HOOK3-BAALC | chr8 | 42780772 | ENST00000307602 | chr8 | 104240217 | ENST00000309982 | TCGA-K4-A6MB-01A |
Top |
Potential target of CAR-T therapy development for HOOK3-BAALC |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HOOK3-BAALC |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HOOK3-BAALC |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | HOOK3 | C0032460 | Polycystic Ovary Syndrome | 1 | CTD_human |
Hgene | HOOK3 | C1136382 | Sclerocystic Ovaries | 1 | CTD_human |