![]() |
|||||||
|
Fusion Protein:IQGAP1-MESP2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: IQGAP1-MESP2 | FusionPDB ID: 40162 | FusionGDB2.0 ID: 40162 | Hgene | Tgene | Gene symbol | IQGAP1 | MESP2 | Gene ID | 8826 | 145873 |
Gene name | IQ motif containing GTPase activating protein 1 | mesoderm posterior bHLH transcription factor 2 | |
Synonyms | HUMORFA01|SAR1|p195 | SCDO2|bHLHc6 | |
Cytomap | 15q26.1 | 15q26.1 | |
Type of gene | protein-coding | protein-coding | |
Description | ras GTPase-activating-like protein IQGAP1RasGAP-like with IQ motifs | mesoderm posterior protein 2class C basic helix-loop-helix protein 6mesoderm posterior 2 homologmesoderm posterior basic helix-loop-helix transcription factor 2 | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | P46940 Main function of 5'-partner protein: FUNCTION: Plays a crucial role in regulating the dynamics and assembly of the actin cytoskeleton. Binds to activated CDC42 but does not stimulate its GTPase activity. It associates with calmodulin. Could serve as an assembly scaffold for the organization of a multimolecular complex that would interface incoming signals to the reorganization of the actin cytoskeleton at the plasma membrane. May promote neurite outgrowth (PubMed:15695813). May play a possible role in cell cycle regulation by contributing to cell cycle progression after DNA replication arrest (PubMed:20883816). {ECO:0000269|PubMed:15695813, ECO:0000269|PubMed:20883816}. | Q0VG99 Main function of 5'-partner protein: FUNCTION: Transcription factor with important role in somitogenesis. Defines the rostrocaudal patterning of the somite by participating in distinct Notch pathways. Regulates also the FGF signaling pathway. Specifies the rostral half of the somites. Generates rostro-caudal polarity of somites by down-regulating in the presumptive rostral domain DLL1, a Notch ligand. Participates in the segment border formation by activating in the anterior presomitic mesoderm LFNG, a negative regulator of DLL1-Notch signaling. Acts as a strong suppressor of Notch activity. Together with MESP1 is involved in the epithelialization of somitic mesoderm and in the development of cardiac mesoderm. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000268182, ENST00000560020, ENST00000560738, | ENST00000341735, ENST00000558723, ENST00000560219, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 27 X 20 X 12=6480 | 5 X 4 X 4=80 |
# samples | 32 | 5 | |
** MAII score | log2(32/6480*10)=-4.33985000288463 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(5/80*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: IQGAP1 [Title/Abstract] AND MESP2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: IQGAP1 [Title/Abstract] AND MESP2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | IQGAP1(90972898)-MESP2(90321296), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | IQGAP1-MESP2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IQGAP1-MESP2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | IQGAP1 | GO:0071277 | cellular response to calcium ion | 18567582 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:90972898/chr15:90321296) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000268182 | IQGAP1 | chr15 | 90972898 | - | ENST00000560219 | MESP2 | chr15 | 90321296 | + | 1201 | 514 | 124 | 783 | 219 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000268182 | ENST00000560219 | IQGAP1 | chr15 | 90972898 | - | MESP2 | chr15 | 90321296 | + | 0.008583513 | 0.9914165 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for IQGAP1-MESP2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
IQGAP1 | chr15 | 90972898 | MESP2 | chr15 | 90321296 | 514 | 130 | QWLNAMDEIGLPKGLSVSPEPCLSLG |
Top |
Potential FusionNeoAntigen Information of IQGAP1-MESP2 in HLA I |
![]() |
IQGAP1-MESP2_90972898_90321296.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:01 | DEIGLPKGL | 0.9808 | 0.9593 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B52:01 | IGLPKGLSV | 0.9663 | 0.9969 | 8 | 17 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B08:09 | IGLPKGLSV | 0.9599 | 0.896 | 8 | 17 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:03 | DEIGLPKGL | 0.959 | 0.9544 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:03 | AMDEIGLPKGL | 0.9888 | 0.981 | 4 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-C15:06 | IGLPKGLSV | 0.9977 | 0.9768 | 8 | 17 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B78:01 | LPKGLSVSP | 0.7649 | 0.6109 | 10 | 19 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-A02:07 | AMDEIGLPKGL | 0.9943 | 0.6639 | 4 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:10 | AMDEIGLPKGL | 0.9743 | 0.5874 | 4 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-C15:02 | IGLPKGLSV | 0.9984 | 0.978 | 8 | 17 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-C15:05 | IGLPKGLSV | 0.998 | 0.9866 | 8 | 17 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B40:04 | DEIGLPKGL | 0.9896 | 0.7502 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:04 | DEIGLPKGL | 0.9891 | 0.9649 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:07 | DEIGLPKGL | 0.9847 | 0.9167 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:08 | DEIGLPKGL | 0.982 | 0.9491 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:05 | DEIGLPKGL | 0.9808 | 0.9593 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:03 | DEIGLPKGL | 0.9621 | 0.9565 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:06 | DEIGLPKGL | 0.9618 | 0.9633 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:26 | DEIGLPKGL | 0.959 | 0.9544 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:13 | DEIGLPKGL | 0.959 | 0.9544 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:07 | DEIGLPKGL | 0.959 | 0.9544 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B78:02 | LPKGLSVSP | 0.7402 | 0.6376 | 10 | 19 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:11 | DEIGLPKGL | 0.6609 | 0.9542 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B39:31 | DEIGLPKGL | 0.3553 | 0.9582 | 6 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B07:13 | IGLPKGLSV | 0.3137 | 0.8723 | 8 | 17 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:26 | AMDEIGLPKGL | 0.9888 | 0.981 | 4 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:13 | AMDEIGLPKGL | 0.9888 | 0.981 | 4 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B44:07 | AMDEIGLPKGL | 0.9888 | 0.981 | 4 | 15 |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 | HLA-B18:03 | DEIGLPKGLSV | 0.9869 | 0.9547 | 6 | 17 |
Top |
Potential FusionNeoAntigen Information of IQGAP1-MESP2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of IQGAP1-MESP2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1066 | DEIGLPKGLSVSPE | IQGAP1 | MESP2 | chr15 | 90972898 | chr15 | 90321296 | 514 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of IQGAP1-MESP2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1066 | DEIGLPKGLSVSPE | -6.46878 | -6.66328 |
HLA-B14:02 | 3BVN | 1066 | DEIGLPKGLSVSPE | -4.33704 | -5.09154 |
HLA-B52:01 | 3W39 | 1066 | DEIGLPKGLSVSPE | -6.45088 | -7.20538 |
HLA-B52:01 | 3W39 | 1066 | DEIGLPKGLSVSPE | -6.08714 | -6.28164 |
HLA-A11:01 | 4UQ2 | 1066 | DEIGLPKGLSVSPE | -7.67344 | -8.42794 |
HLA-A24:02 | 5HGA | 1066 | DEIGLPKGLSVSPE | -7.49907 | -7.69357 |
HLA-A24:02 | 5HGA | 1066 | DEIGLPKGLSVSPE | -4.36357 | -5.11807 |
HLA-B27:05 | 6PYJ | 1066 | DEIGLPKGLSVSPE | -8.53231 | -9.28681 |
HLA-B44:05 | 3DX8 | 1066 | DEIGLPKGLSVSPE | -5.69992 | -5.89442 |
HLA-B44:05 | 3DX8 | 1066 | DEIGLPKGLSVSPE | -3.58931 | -4.34381 |
HLA-A02:01 | 6TDR | 1066 | DEIGLPKGLSVSPE | -7.78181 | -7.97631 |
Top |
Vaccine Design for the FusionNeoAntigens of IQGAP1-MESP2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 10 | 19 | LPKGLSVSP | TTGCCTAAGGGTCTCTCTGTGTCTCCA |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 4 | 15 | AMDEIGLPKGL | GCCATGGATGAGATTGGATTGCCTAAGGGTCTC |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 6 | 15 | DEIGLPKGL | GATGAGATTGGATTGCCTAAGGGTCTC |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 6 | 17 | DEIGLPKGLSV | GATGAGATTGGATTGCCTAAGGGTCTCTCTGTG |
IQGAP1-MESP2 | chr15 | 90972898 | chr15 | 90321296 | 8 | 17 | IGLPKGLSV | ATTGGATTGCCTAAGGGTCTCTCTGTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of IQGAP1-MESP2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | IQGAP1-MESP2 | chr15 | 90972898 | ENST00000268182 | chr15 | 90321296 | ENST00000560219 | TCGA-BH-A0C0-01A |
Top |
Potential target of CAR-T therapy development for IQGAP1-MESP2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to IQGAP1-MESP2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to IQGAP1-MESP2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |