Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ITGB4-ACHE

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ITGB4-ACHE
	FusionPDB ID: 40530
	FusionGDB2.0 ID: 40530
		Hgene	Tgene
	Gene symbol	ITGB4	ACHE
	Gene ID	3691	43
	Gene name	integrin subunit beta 4	acetylcholinesterase (Cartwright blood group)
	Synonyms	CD104\|GP150	ACEE\|ARACHE\|N-ACHE\|YT
	Cytomap	17q25.1	7q22.1
	Type of gene	protein-coding	protein-coding
	Description	integrin beta-4CD104 antigen	acetylcholinesteraseYt blood groupacetylcholinesterase (Yt blood group)apoptosis-related acetylcholinesterase
	Modification date	20200329	20200313
	UniProtAcc	P16144 Main function of 5'-partner protein: FUNCTION: Integrin alpha-6/beta-4 is a receptor for laminin. Plays a critical structural role in the hemidesmosome of epithelial cells. Is required for the regulation of keratinocyte polarity and motility. ITGA6:ITGB4 binds to NRG1 (via EGF domain) and this binding is essential for NRG1-ERBB signaling (PubMed:20682778). ITGA6:ITGB4 binds to IGF1 and this binding is essential for IGF1 signaling (PubMed:22351760). ITGA6:ITGB4 binds to IGF2 and this binding is essential for IGF2 signaling (PubMed:28873464). {ECO:0000269\|PubMed:12482924, ECO:0000269\|PubMed:19403692, ECO:0000269\|PubMed:20682778, ECO:0000269\|PubMed:22351760, ECO:0000269\|PubMed:28873464}.	P22303 Main function of 5'-partner protein: FUNCTION: Terminates signal transduction at the neuromuscular junction by rapid hydrolysis of the acetylcholine released into the synaptic cleft. Role in neuronal apoptosis. {ECO:0000269\|PubMed:11985878, ECO:0000269\|PubMed:1517212, ECO:0000269\|PubMed:1748670, ECO:0000269\|PubMed:2714437}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000200181, ENST00000339591, ENST00000449880, ENST00000450894, ENST00000579662, ENST00000584558,	ENST00000497647, ENST00000412389, ENST00000241069, ENST00000302913, ENST00000411582, ENST00000419336, ENST00000428317,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	23 X 19 X 10=4370	6 X 5 X 5=150
	# samples	29	6
	** MAII score	log2(29/4370*10)=-3.91350847437303 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/150*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ITGB4 [Title/Abstract] AND ACHE [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ITGB4 [Title/Abstract] AND ACHE [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ITGB4(73752698)-ACHE(100491525), # samples:1
Anticipated loss of major functional domain due to fusion event.	ITGB4-ACHE seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ITGB4-ACHE seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ITGB4-ACHE seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ITGB4-ACHE seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ITGB4-ACHE seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ITGB4-ACHE seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ITGB4-ACHE seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. ITGB4-ACHE seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ITGB4-ACHE seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ITGB4	GO:0009611	response to wounding	19403692
Hgene	ITGB4	GO:0031581	hemidesmosome assembly	12482924
Tgene	ACHE	GO:0006581	acetylcholine catabolic process	1517212
Tgene	ACHE	GO:0007155	cell adhesion	15454088

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:73752698/chr7:100491525)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ITGB4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ACHE (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000579662	ITGB4	chr17	73752698	+	ENST00000419336	ACHE	chr7	100491525	-	6406	4933	246	5054	1602
ENST00000579662	ITGB4	chr17	73752698	+	ENST00000241069	ACHE	chr7	100491525	-	6670	4933	246	5054	1602
ENST00000579662	ITGB4	chr17	73752698	+	ENST00000428317	ACHE	chr7	100491525	-	6670	4933	246	5054	1602
ENST00000579662	ITGB4	chr17	73752698	+	ENST00000302913	ACHE	chr7	100491525	-	7422	4933	246	5063	1605
ENST00000579662	ITGB4	chr17	73752698	+	ENST00000411582	ACHE	chr7	100491525	-	6701	4933	246	5063	1605
ENST00000339591	ITGB4	chr17	73752698	+	ENST00000419336	ACHE	chr7	100491525	-	6506	5033	163	5154	1663
ENST00000339591	ITGB4	chr17	73752698	+	ENST00000241069	ACHE	chr7	100491525	-	6770	5033	163	5154	1663
ENST00000339591	ITGB4	chr17	73752698	+	ENST00000428317	ACHE	chr7	100491525	-	6770	5033	163	5154	1663
ENST00000339591	ITGB4	chr17	73752698	+	ENST00000302913	ACHE	chr7	100491525	-	7522	5033	163	5163	1666
ENST00000339591	ITGB4	chr17	73752698	+	ENST00000411582	ACHE	chr7	100491525	-	6801	5033	163	5163	1666
ENST00000200181	ITGB4	chr17	73752698	+	ENST00000419336	ACHE	chr7	100491525	-	6557	5084	163	5205	1680
ENST00000200181	ITGB4	chr17	73752698	+	ENST00000241069	ACHE	chr7	100491525	-	6821	5084	163	5205	1680
ENST00000200181	ITGB4	chr17	73752698	+	ENST00000428317	ACHE	chr7	100491525	-	6821	5084	163	5205	1680
ENST00000200181	ITGB4	chr17	73752698	+	ENST00000302913	ACHE	chr7	100491525	-	7573	5084	163	5214	1683
ENST00000200181	ITGB4	chr17	73752698	+	ENST00000411582	ACHE	chr7	100491525	-	6852	5084	163	5214	1683
ENST00000450894	ITGB4	chr17	73752698	+	ENST00000419336	ACHE	chr7	100491525	-	6286	4813	102	4934	1610
ENST00000450894	ITGB4	chr17	73752698	+	ENST00000241069	ACHE	chr7	100491525	-	6550	4813	102	4934	1610
ENST00000450894	ITGB4	chr17	73752698	+	ENST00000428317	ACHE	chr7	100491525	-	6550	4813	102	4934	1610
ENST00000450894	ITGB4	chr17	73752698	+	ENST00000302913	ACHE	chr7	100491525	-	7302	4813	102	4943	1613
ENST00000450894	ITGB4	chr17	73752698	+	ENST00000411582	ACHE	chr7	100491525	-	6581	4813	102	4943	1613
ENST00000449880	ITGB4	chr17	73752698	+	ENST00000419336	ACHE	chr7	100491525	-	6327	4854	8	4975	1655
ENST00000449880	ITGB4	chr17	73752698	+	ENST00000241069	ACHE	chr7	100491525	-	6591	4854	8	4975	1655
ENST00000449880	ITGB4	chr17	73752698	+	ENST00000428317	ACHE	chr7	100491525	-	6591	4854	8	4975	1655
ENST00000449880	ITGB4	chr17	73752698	+	ENST00000302913	ACHE	chr7	100491525	-	7343	4854	8	4984	1658
ENST00000449880	ITGB4	chr17	73752698	+	ENST00000411582	ACHE	chr7	100491525	-	6622	4854	8	4984	1658

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000579662	ENST00000419336	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001461694	0.99853826
ENST00000579662	ENST00000241069	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001317969	0.99868196
ENST00000579662	ENST00000428317	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001317969	0.99868196
ENST00000579662	ENST00000302913	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001706066	0.99829394
ENST00000579662	ENST00000411582	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001683204	0.99831676
ENST00000339591	ENST00000419336	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.003941387	0.9960586
ENST00000339591	ENST00000241069	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.003704837	0.99629515
ENST00000339591	ENST00000428317	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.003704837	0.99629515
ENST00000339591	ENST00000302913	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.002051357	0.9979487
ENST00000339591	ENST00000411582	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.002010091	0.9979899
ENST00000200181	ENST00000419336	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.003088297	0.9969117
ENST00000200181	ENST00000241069	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.002887259	0.99711275
ENST00000200181	ENST00000428317	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.002887259	0.99711275
ENST00000200181	ENST00000302913	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.006035319	0.99396473
ENST00000200181	ENST00000411582	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.005861681	0.99413836
ENST00000450894	ENST00000419336	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001324924	0.99867505
ENST00000450894	ENST00000241069	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001189953	0.99881005
ENST00000450894	ENST00000428317	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001189953	0.99881005
ENST00000450894	ENST00000302913	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001520754	0.9984793
ENST00000450894	ENST00000411582	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001520594	0.9984794
ENST00000449880	ENST00000419336	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.003216515	0.9967835
ENST00000449880	ENST00000241069	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.002993568	0.9970065
ENST00000449880	ENST00000428317	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.002993568	0.9970065
ENST00000449880	ENST00000302913	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001668215	0.99833184
ENST00000449880	ENST00000411582	ITGB4	chr17	73752698	+	ACHE	chr7	100491525	-	0.001655795	0.9983442

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ITGB4-ACHE

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ITGB4	chr17	73752698	ACHE	chr7	100491525	4813	1565	VITIESQVHPQSPLCPLPDTLDEAER
ITGB4	chr17	73752698	ACHE	chr7	100491525	4854	1610	VITIESQVHPQSPLCPLPDTLDEAER
ITGB4	chr17	73752698	ACHE	chr7	100491525	4933	1557	VITIESQVHPQSPLCPLPDTLDEAER
ITGB4	chr17	73752698	ACHE	chr7	100491525	5033	1618	VITIESQVHPQSPLCPLPDTLDEAER
ITGB4	chr17	73752698	ACHE	chr7	100491525	5084	1635	VITIESQVHPQSPLCPLPDTLDEAER

Top

Potential FusionNeoAntigen Information of ITGB4-ACHE in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ITGB4-ACHE_73752698_100491525.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:24	SQVHPQSPL	0.9915	0.5269	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:01	HPQSPLCPL	0.9868	0.8447	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:03	HPQSPLCPL	0.9855	0.8644	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:01	SQVHPQSPL	0.9834	0.7892	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:08	HPQSPLCPL	0.9758	0.7921	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:01	SQVHPQSPL	0.9652	0.8153	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:02	HPQSPLCPL	0.9555	0.9434	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:04	HPQSPLCPL	0.9555	0.9434	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:05	HPQSPLCPL	0.9423	0.6194	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:13	SQVHPQSPL	0.8871	0.8589	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:10	SQVHPQSPL	0.858	0.5314	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B13:02	SQVHPQSPL	0.8115	0.6844	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:03	SQVHPQSPL	0.779	0.7105	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B13:01	SQVHPQSPL	0.742	0.9379	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:25	SQVHPQSPL	0.6837	0.8698	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:37	SQVHPQSPL	0.634	0.6274	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:03	SPLCPLPDTL	0.9001	0.8478	11	21
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:02	SPLCPLPDTL	0.775	0.8413	11	21
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:04	SPLCPLPDTL	0.775	0.8413	11	21
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:08	SQVHPQSPL	0.9821	0.7687	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B07:12	HPQSPLCPL	0.9764	0.539	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:09	SQVHPQSPL	0.9714	0.6387	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:12	HPQSPLCPL	0.9555	0.9434	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:04	SQVHPQSPL	0.9262	0.8392	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:10	HPQSPLCPL	0.9146	0.9048	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:05	SQVHPQSPL	0.8549	0.8047	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B42:02	HPQSPLCPL	0.8449	0.5343	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B42:01	HPQSPLCPL	0.8143	0.5251	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B14:03	SQVHPQSPL	0.6665	0.8214	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:09	VHPQSPLCPL	0.971	0.7034	7	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:12	SPLCPLPDTL	0.775	0.8413	11	21
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:10	SPLCPLPDTL	0.7645	0.8199	11	21
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:77	HPQSPLCPL	0.9868	0.8447	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:23	HPQSPLCPL	0.9864	0.8426	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:27	SQVHPQSPL	0.9834	0.8027	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:125	SQVHPQSPL	0.9834	0.7892	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:34	SQVHPQSPL	0.9834	0.7892	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:33	SQVHPQSPL	0.9834	0.7892	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:13	HPQSPLCPL	0.9824	0.8688	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:02	SQVHPQSPL	0.9792	0.8486	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:31	SQVHPQSPL	0.9675	0.8164	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:73	SQVHPQSPL	0.9635	0.9128	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:11	HPQSPLCPL	0.9602	0.8324	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:09	HPQSPLCPL	0.9555	0.9434	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:30	HPQSPLCPL	0.953	0.7495	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:17	HPQSPLCPL	0.953	0.7495	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B39:11	SQVHPQSPL	0.9527	0.6981	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:50	SQVHPQSPL	0.9479	0.7839	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B67:01	HPQSPLCPL	0.933	0.7359	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:53	SQVHPQSPL	0.9328	0.7781	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:30	SQVHPQSPL	0.892	0.8814	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:68	SQVHPQSPL	0.8913	0.5296	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:24	HPQSPLCPL	0.855	0.8467	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:54	SQVHPQSPL	0.8455	0.7413	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B48:02	SQVHPQSPL	0.7124	0.823	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:09	SQVHPQSPL	0.7102	0.7288	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:39	SQVHPQSPL	0.683	0.7665	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B15:20	SQVHPQSPL	0.3478	0.8435	5	14
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:43	HPQSPLCPL	0.1177	0.7717	8	17
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:13	SPLCPLPDTL	0.8656	0.8507	11	21
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B35:09	SPLCPLPDTL	0.775	0.8413	11	21
ITGB4-ACHE	chr17	73752698	chr7	100491525	5084	HLA-B67:01	SPLCPLPDTL	0.7303	0.7088	11	21

Top

Potential FusionNeoAntigen Information of ITGB4-ACHE in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ITGB4-ACHE

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7615	QVHPQSPLCPLPDT	ITGB4	ACHE	chr17	73752698	chr7	100491525	5084

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ITGB4-ACHE

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7615	QVHPQSPLCPLPDT	-7.9962	-8.1096
HLA-B14:02	3BVN	7615	QVHPQSPLCPLPDT	-5.70842	-6.74372
HLA-B52:01	3W39	7615	QVHPQSPLCPLPDT	-6.83737	-6.95077
HLA-B52:01	3W39	7615	QVHPQSPLCPLPDT	-4.4836	-5.5189
HLA-A11:01	4UQ2	7615	QVHPQSPLCPLPDT	-10.0067	-10.1201
HLA-A11:01	4UQ2	7615	QVHPQSPLCPLPDT	-9.03915	-10.0745
HLA-A24:02	5HGA	7615	QVHPQSPLCPLPDT	-6.56204	-6.67544
HLA-A24:02	5HGA	7615	QVHPQSPLCPLPDT	-5.42271	-6.45801
HLA-B44:05	3DX8	7615	QVHPQSPLCPLPDT	-7.85648	-8.89178
HLA-B44:05	3DX8	7615	QVHPQSPLCPLPDT	-5.3978	-5.5112
HLA-A02:01	6TDR	7615	QVHPQSPLCPLPDT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ITGB4-ACHE

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ITGB4-ACHE	chr17	73752698	chr7	100491525	11	21	SPLCPLPDTL	TGCCAGACACGCTCGACGAGGCGGAGCGCC
ITGB4-ACHE	chr17	73752698	chr7	100491525	5	14	SQVHPQSPL	AGAGCCCACTGTGTCCCCTGCCAGACA
ITGB4-ACHE	chr17	73752698	chr7	100491525	7	17	VHPQSPLCPL	CACTGTGTCCCCTGCCAGACACGCTCGACG
ITGB4-ACHE	chr17	73752698	chr7	100491525	8	17	HPQSPLCPL	TGTGTCCCCTGCCAGACACGCTCGACG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ITGB4-ACHE

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ITGB4-ACHE	chr17	73752698	ENST00000200181	chr7	100491525	ENST00000241069	TCGA-D7-8576-01A

Top

Potential target of CAR-T therapy development for ITGB4-ACHE

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

ITGB4

chr17:73752698

chr7:100491525

ENST00000200181

711_733

1632

1823.0

Transmembrane

Helical

Hgene

ITGB4

chr17:73752698

chr7:100491525

ENST00000339591

711_733

1615

1806.0

Transmembrane

Helical

Hgene

ITGB4

chr17:73752698

chr7:100491525

ENST00000449880

711_733

1615

1806.0

Transmembrane

Helical

Hgene

ITGB4

chr17:73752698

chr7:100491525

ENST00000450894

711_733

1562

1753.0

Transmembrane

Helical

Hgene

ITGB4

chr17:73752698

chr7:100491525

ENST00000579662

711_733

1562

1753.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ITGB4-ACHE

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ITGB4-ACHE

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)