![]() |
|||||||
|
Fusion Protein:ABHD17C-BHLHE41 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ABHD17C-BHLHE41 | FusionPDB ID: 407 | FusionGDB2.0 ID: 28330 | Hgene | Tgene | Gene symbol | ABHD17C | BHLHE41 | Gene ID | 58489 | 79365 |
Gene name | abhydrolase domain containing 17C, depalmitoylase | basic helix-loop-helix family member e41 | |
Synonyms | FAM108C1 | BHLHB3|DEC2|FNSS1|SHARP1|hDEC2 | |
Cytomap | 15q25.1 | 12p12.1 | |
Type of gene | protein-coding | protein-coding | |
Description | alpha/beta hydrolase domain-containing protein 17Cabhydrolase domain containing 17Cabhydrolase domain-containing protein 17Cabhydrolase domain-containing protein FAM108C1family with sequence similarity 108, member C1protein ABHD17C | class E basic helix-loop-helix protein 41basic helix-loop-helix domain containing, class B, 3differentially expressed in chondrocytes protein 2enhancer-of-split and hairy-related protein 1 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q6PCB6 Main function of 5'-partner protein: FUNCTION: Hydrolyzes fatty acids from S-acylated cysteine residues in proteins. Has depalmitoylating activity towards NRAS and DLG4/PSD95. {ECO:0000269|PubMed:26701913}. | Q9C0J9 Main function of 5'-partner protein: FUNCTION: Transcriptional repressor involved in the regulation of the circadian rhythm by negatively regulating the activity of the clock genes and clock-controlled genes (PubMed:11278948, PubMed:14672706, PubMed:15193144, PubMed:15560782, PubMed:18411297, PubMed:19786558, PubMed:25083013). Acts as the negative limb of a novel autoregulatory feedback loop (DEC loop) which differs from the one formed by the PER and CRY transcriptional repressors (PER/CRY loop). Both these loops are interlocked as it represses the expression of PER1 and in turn is repressed by PER1/2 and CRY1/2. Represses the activity of the circadian transcriptional activator: CLOCK-ARNTL/BMAL1 heterodimer by competing for the binding to E-box elements (5'-CACGTG-3') found within the promoters of its target genes (PubMed:25083013). Negatively regulates its own expression and the expression of DBP and BHLHE41/DEC2. Acts as a corepressor of RXR and the RXR-LXR heterodimers and represses the ligand-induced RXRA/B/G, NR1H3/LXRA, NR1H4 and VDR transactivation activity. Inhibits HNF1A-mediated transactivation of CYP1A2, CYP2E1 AND CYP3A11 (By similarity). {ECO:0000250|UniProtKB:Q99PV5, ECO:0000269|PubMed:11278948, ECO:0000269|PubMed:14672706, ECO:0000269|PubMed:15193144, ECO:0000269|PubMed:15560782, ECO:0000269|PubMed:18411297, ECO:0000269|PubMed:19786558, ECO:0000269|PubMed:25083013}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000258884, ENST00000558464, ENST00000559506, ENST00000560609, | ENST00000242728, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 4 X 3 X 4=48 | 5 X 2 X 4=40 |
# samples | 4 | 5 | |
** MAII score | log2(4/48*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(5/40*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: ABHD17C [Title/Abstract] AND BHLHE41 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ABHD17C [Title/Abstract] AND BHLHE41 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ABHD17C(80988360)-BHLHE41(26277515), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | ABHD17C-BHLHE41 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ABHD17C-BHLHE41 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | BHLHE41 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 14672706|15193144 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:80988360/chr12:26277515) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000258884 | ABHD17C | chr15 | 80988360 | + | ENST00000242728 | BHLHE41 | chr12 | 26277515 | - | 4144 | 717 | 10 | 2103 | 697 |
ENST00000558464 | ABHD17C | chr15 | 80988360 | + | ENST00000242728 | BHLHE41 | chr12 | 26277515 | - | 4136 | 709 | 2 | 2095 | 697 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000258884 | ENST00000242728 | ABHD17C | chr15 | 80988360 | + | BHLHE41 | chr12 | 26277515 | - | 0.002852121 | 0.99714786 |
ENST00000558464 | ENST00000242728 | ABHD17C | chr15 | 80988360 | + | BHLHE41 | chr12 | 26277515 | - | 0.002879293 | 0.9971207 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ABHD17C-BHLHE41 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ABHD17C | chr15 | 80988360 | BHLHE41 | chr12 | 26277515 | 709 | 235 | YADIDAAWQALRTRLDYSSLYMCKPK |
ABHD17C | chr15 | 80988360 | BHLHE41 | chr12 | 26277515 | 717 | 235 | YADIDAAWQALRTRLDYSSLYMCKPK |
Top |
Potential FusionNeoAntigen Information of ABHD17C-BHLHE41 in HLA I |
![]() |
ABHD17C-BHLHE41_80988360_26277515.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B14:01 | TRLDYSSL | 0.9991 | 0.5529 | 12 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B14:02 | TRLDYSSL | 0.9991 | 0.5529 | 12 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:37 | TRLDYSSL | 0.9828 | 0.5925 | 12 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:05 | TRLDYSSLY | 0.9992 | 0.8381 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:02 | TRLDYSSLY | 0.9992 | 0.5066 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:04 | TRLDYSSLY | 0.9991 | 0.6706 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A30:08 | RTRLDYSSL | 0.9892 | 0.6796 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:17 | RTRLDYSSL | 0.9818 | 0.8792 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:16 | RTRLDYSSL | 0.9672 | 0.6752 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A74:03 | AAWQALRTR | 0.9607 | 0.9421 | 5 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A74:09 | AAWQALRTR | 0.9607 | 0.9421 | 5 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A74:11 | AAWQALRTR | 0.9607 | 0.9421 | 5 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A31:06 | AAWQALRTR | 0.9188 | 0.907 | 5 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A31:02 | AAWQALRTR | 0.8961 | 0.932 | 5 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:03 | TRLDYSSLY | 0.3653 | 0.6868 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:18 | TRLDYSSLY | 0.3128 | 0.6729 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:04 | TRLDYSSLYM | 0.9999 | 0.6617 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:02 | TRLDYSSLYM | 0.9999 | 0.5058 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:17 | RTRLDYSSLY | 0.9965 | 0.8162 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:05 | RTRLDYSSLY | 0.9953 | 0.8259 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:02 | RTRLDYSSLY | 0.9943 | 0.5294 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A68:24 | DAAWQALRTR | 0.9932 | 0.9555 | 4 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:04 | RTRLDYSSLY | 0.9924 | 0.6587 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A68:03 | DAAWQALRTR | 0.9917 | 0.9504 | 4 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A30:08 | RTRLDYSSLY | 0.991 | 0.5162 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A33:01 | DAAWQALRTR | 0.9903 | 0.8807 | 4 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A33:05 | DAAWQALRTR | 0.9903 | 0.8807 | 4 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:16 | RTRLDYSSLY | 0.9859 | 0.6732 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A68:06 | DAAWQALRTR | 0.9814 | 0.9492 | 4 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A68:05 | DAAWQALRTR | 0.9347 | 0.9568 | 4 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:02 | LRTRLDYSSLY | 0.9999 | 0.5331 | 10 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B39:12 | TRLDYSSL | 0.9994 | 0.8556 | 12 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B14:03 | TRLDYSSL | 0.9156 | 0.6389 | 12 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:95 | TRLDYSSLY | 0.9978 | 0.5398 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:14 | TRLDYSSLY | 0.9975 | 0.7637 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:27 | TRLDYSSLY | 0.9948 | 0.9245 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C15:06 | RTRLDYSSL | 0.994 | 0.8319 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:03 | TRLDYSSLY | 0.9931 | 0.8741 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:05 | TRLDYSSLY | 0.993 | 0.9309 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C03:08 | RTRLDYSSL | 0.9784 | 0.9042 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A31:01 | AAWQALRTR | 0.9697 | 0.9294 | 5 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A33:03 | AAWQALRTR | 0.9603 | 0.6335 | 5 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:46 | TRLDYSSLY | 0.9423 | 0.7356 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:67 | TRLDYSSLY | 0.9275 | 0.8882 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:80 | TRLDYSSLY | 0.9275 | 0.8882 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:10 | TRLDYSSLY | 0.8853 | 0.9223 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C12:16 | TRLDYSSLY | 0.0641 | 0.9475 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:27 | TRLDYSSLYM | 0.9995 | 0.932 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:95 | TRLDYSSLYM | 0.9995 | 0.578 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:07 | RTRLDYSSLY | 0.9993 | 0.685 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:03 | TRLDYSSLYM | 0.9988 | 0.8802 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:46 | TRLDYSSLYM | 0.9978 | 0.7687 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C15:04 | RTRLDYSSLY | 0.9946 | 0.7819 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:19 | RTRLDYSSLY | 0.9941 | 0.5199 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A68:01 | DAAWQALRTR | 0.9932 | 0.9555 | 4 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:14 | RTRLDYSSLY | 0.9903 | 0.7606 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:95 | RTRLDYSSLY | 0.9861 | 0.5546 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:46 | RTRLDYSSLY | 0.972 | 0.779 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:03 | RTRLDYSSLY | 0.9389 | 0.8581 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A33:03 | DAAWQALRTR | 0.9253 | 0.8804 | 4 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B39:31 | TRLDYSSL | 0.9996 | 0.8512 | 12 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B48:05 | WQALRTRL | 0.8175 | 0.5081 | 7 | 15 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:08 | TRLDYSSLY | 0.9992 | 0.7291 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:10 | TRLDYSSLY | 0.999 | 0.7944 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B07:13 | RTRLDYSSL | 0.9918 | 0.7846 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A30:01 | RTRLDYSSL | 0.9897 | 0.8495 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:17 | TRLDYSSLY | 0.9856 | 0.9425 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:09 | TRLDYSSLY | 0.9755 | 0.8 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A74:01 | AAWQALRTR | 0.9607 | 0.9421 | 5 | 14 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A32:01 | RTRLDYSSL | 0.9581 | 0.8661 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:02 | TRLDYSSLY | 0.9275 | 0.8882 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:22 | TRLDYSSLY | 0.8467 | 0.6099 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:30 | RTRLDYSSL | 0.8362 | 0.7542 | 11 | 20 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C06:08 | TRLDYSSLY | 0.6845 | 0.9595 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B48:02 | TRLDYSSLY | 0.5312 | 0.8423 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C06:06 | TRLDYSSLY | 0.1641 | 0.967 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:54 | TRLDYSSLY | 0.0742 | 0.814 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:68 | TRLDYSSLY | 0.0352 | 0.5894 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C06:17 | TRLDYSSLY | 0.0146 | 0.9803 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C06:02 | TRLDYSSLY | 0.0146 | 0.9803 | 12 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:08 | TRLDYSSLYM | 0.9999 | 0.7142 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:09 | TRLDYSSLYM | 0.9998 | 0.7824 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:06 | TRLDYSSLYM | 0.9998 | 0.6312 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:01 | TRLDYSSLYM | 0.9996 | 0.5118 | 12 | 22 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:135 | RTRLDYSSLY | 0.9995 | 0.8772 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B15:35 | RTRLDYSSLY | 0.9992 | 0.8402 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B57:04 | RTRLDYSSLY | 0.9992 | 0.6171 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B58:06 | RTRLDYSSLY | 0.9977 | 0.6453 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:22 | RTRLDYSSLY | 0.9963 | 0.625 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C07:01 | RTRLDYSSLY | 0.9946 | 0.5325 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-C15:09 | RTRLDYSSLY | 0.9946 | 0.7819 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:10 | RTRLDYSSLY | 0.994 | 0.7876 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:08 | RTRLDYSSLY | 0.9938 | 0.6936 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-A30:01 | RTRLDYSSLY | 0.991 | 0.7357 | 11 | 21 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | HLA-B27:09 | RTRLDYSSLY | 0.9268 | 0.7995 | 11 | 21 |
Top |
Potential FusionNeoAntigen Information of ABHD17C-BHLHE41 in HLA II |
![]() |
ABHD17C-BHLHE41_80988360_26277515.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0405 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0424 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0424 | IDAAWQALRTRLDYS | 3 | 18 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0429 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0430 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0445 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0447 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0448 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0454 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0457 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0477 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0480 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0480 | IDAAWQALRTRLDYS | 3 | 18 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0482 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0483 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0484 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0486 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0486 | IDAAWQALRTRLDYS | 3 | 18 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0486 | DIDAAWQALRTRLDY | 2 | 17 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0489 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0832 | DAAWQALRTRLDYSS | 4 | 19 |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 | DRB1-0832 | IDAAWQALRTRLDYS | 3 | 18 |
Top |
Fusion breakpoint peptide structures of ABHD17C-BHLHE41 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
729 | AWQALRTRLDYSSL | ABHD17C | BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 717 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ABHD17C-BHLHE41 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 729 | AWQALRTRLDYSSL | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 729 | AWQALRTRLDYSSL | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 729 | AWQALRTRLDYSSL | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 729 | AWQALRTRLDYSSL | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 729 | AWQALRTRLDYSSL | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 729 | AWQALRTRLDYSSL | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 729 | AWQALRTRLDYSSL | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 729 | AWQALRTRLDYSSL | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 729 | AWQALRTRLDYSSL | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 729 | AWQALRTRLDYSSL | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 729 | AWQALRTRLDYSSL | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of ABHD17C-BHLHE41 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 10 | 21 | LRTRLDYSSLY | GCGCACCCGACTGGACTATTCCTCTTTGTATAT |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 11 | 20 | RTRLDYSSL | CACCCGACTGGACTATTCCTCTTTGTA |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 11 | 21 | RTRLDYSSLY | CACCCGACTGGACTATTCCTCTTTGTATAT |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 12 | 20 | TRLDYSSL | CCGACTGGACTATTCCTCTTTGTA |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 12 | 21 | TRLDYSSLY | CCGACTGGACTATTCCTCTTTGTATAT |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 12 | 22 | TRLDYSSLYM | CCGACTGGACTATTCCTCTTTGTATATGTG |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 4 | 14 | DAAWQALRTR | CGCCGCGTGGCAGGCGCTGCGCACCCGACT |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 5 | 14 | AAWQALRTR | CGCGTGGCAGGCGCTGCGCACCCGACT |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 7 | 15 | WQALRTRL | GCAGGCGCTGCGCACCCGACTGGA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 2 | 17 | DIDAAWQALRTRLDY | CATCGACGCCGCGTGGCAGGCGCTGCGCACCCGACTGGACTATTC |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 3 | 18 | IDAAWQALRTRLDYS | CGACGCCGCGTGGCAGGCGCTGCGCACCCGACTGGACTATTCCTC |
ABHD17C-BHLHE41 | chr15 | 80988360 | chr12 | 26277515 | 4 | 19 | DAAWQALRTRLDYSS | CGCCGCGTGGCAGGCGCTGCGCACCCGACTGGACTATTCCTCTTT |
Top |
Information of the samples that have these potential fusion neoantigens of ABHD17C-BHLHE41 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | ABHD17C-BHLHE41 | chr15 | 80988360 | ENST00000258884 | chr12 | 26277515 | ENST00000242728 | TCGA-D7-8575-01A |
Top |
Potential target of CAR-T therapy development for ABHD17C-BHLHE41 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ABHD17C-BHLHE41 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ABHD17C-BHLHE41 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |