Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KAT6A-GOT1L1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KAT6A-GOT1L1
	FusionPDB ID: 41205
	FusionGDB2.0 ID: 41205
		Hgene	Tgene
	Gene symbol	KAT6A	GOT1L1
	Gene ID	7994	137362
	Gene name	lysine acetyltransferase 6A	glutamic-oxaloacetic transaminase 1 like 1
	Synonyms	ARTHS\|MOZ\|MRD32\|MYST-3\|MYST3\|RUNXBP2\|ZC2HC6A\|ZNF220	-
	Cytomap	8p11.21	8p11.23
	Type of gene	protein-coding	protein-coding
	Description	histone acetyltransferase KAT6AK(lysine) acetyltransferase 6AMOZ, YBF2/SAS3, SAS2 and TIP60 protein 3MYST histone acetyltransferase (monocytic leukemia) 3histone acetyltransferase MYST3monocytic leukemia zinc finger proteinrunt-related transcription	putative aspartate aminotransferase, cytoplasmic 2glutamate oxaloacetate transaminase 1-like protein 1transaminase A-like protein 1
	Modification date	20200313	20200313
	UniProtAcc	Q92794 Main function of 5'-partner protein: FUNCTION: Histone acetyltransferase that acetylates lysine residues in histone H3 and histone H4 (in vitro). Component of the MOZ/MORF complex which has a histone H3 acetyltransferase activity. May act as a transcriptional coactivator for RUNX1 and RUNX2. Acetylates p53/TP53 at 'Lys-120' and 'Lys-382' and controls its transcriptional activity via association with PML. {ECO:0000269\|PubMed:11742995, ECO:0000269\|PubMed:11965546, ECO:0000269\|PubMed:12771199, ECO:0000269\|PubMed:16387653, ECO:0000269\|PubMed:17925393, ECO:0000269\|PubMed:23431171}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000265713, ENST00000396930, ENST00000406337, ENST00000485568,	ENST00000518826, ENST00000307599,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	26 X 32 X 13=10816	3 X 4 X 2=24
	# samples	42	2
	** MAII score	log2(42/10816*10)=-4.68663391861606 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(2/24*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KAT6A [Title/Abstract] AND GOT1L1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KAT6A [Title/Abstract] AND GOT1L1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KAT6A(41905896)-GOT1L1(37794575), # samples:1
Anticipated loss of major functional domain due to fusion event.	KAT6A-GOT1L1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KAT6A-GOT1L1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KAT6A-GOT1L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KAT6A-GOT1L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KAT6A-GOT1L1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. KAT6A-GOT1L1 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. KAT6A-GOT1L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. KAT6A-GOT1L1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. KAT6A-GOT1L1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	KAT6A	GO:0006473	protein acetylation	23431171
Hgene	KAT6A	GO:0016573	histone acetylation	11742995\|17925393
Hgene	KAT6A	GO:0030099	myeloid cell differentiation	11742995
Hgene	KAT6A	GO:0043966	histone H3 acetylation	16387653
Hgene	KAT6A	GO:0045892	negative regulation of transcription, DNA-templated	11742995
Hgene	KAT6A	GO:0045893	positive regulation of transcription, DNA-templated	11742995\|11965546\|18794358

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:41905896/chr8:37794575)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KAT6A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across GOT1L1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000265713	KAT6A	chr8	41905896	-	ENST00000307599	GOT1L1	chr8	37794575	-	1771	1012	412	1758	448
ENST00000396930	KAT6A	chr8	41905896	-	ENST00000307599	GOT1L1	chr8	37794575	-	1903	1144	544	1890	448
ENST00000485568	KAT6A	chr8	41905896	-	ENST00000307599	GOT1L1	chr8	37794575	-	1771	1012	412	1758	448

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000265713	ENST00000307599	KAT6A	chr8	41905896	-	GOT1L1	chr8	37794575	-	0.001071131	0.99892884
ENST00000396930	ENST00000307599	KAT6A	chr8	41905896	-	GOT1L1	chr8	37794575	-	0.001239393	0.9987606
ENST00000485568	ENST00000307599	KAT6A	chr8	41905896	-	GOT1L1	chr8	37794575	-	0.001071131	0.99892884

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KAT6A-GOT1L1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KAT6A	chr8	41905896	GOT1L1	chr8	37794575	1012	200	LPPVSLLPHEKDKQIPHGCVLVMGNI
KAT6A	chr8	41905896	GOT1L1	chr8	37794575	1144	200	LPPVSLLPHEKDKQIPHGCVLVMGNI

Top

Potential FusionNeoAntigen Information of KAT6A-GOT1L1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KAT6A-GOT1L1_41905896_37794575.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:01	KQIPHGCVL	0.994	0.9548	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:01	KQIPHGCVL	0.9936	0.8101	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:24	KQIPHGCVL	0.9891	0.8407	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:01	KQIPHGCVL	0.9549	0.9655	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B14:02	KQIPHGCVL	0.9229	0.9468	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B14:01	KQIPHGCVL	0.9229	0.9468	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B08:01	LPHEKDKQI	0.9068	0.5756	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B08:09	LPHEKDKQI	0.8767	0.7027	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:13	KQIPHGCVL	0.861	0.9759	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B13:02	KQIPHGCVL	0.8421	0.7931	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B18:01	HEKDKQIPH	0.8068	0.6195	8	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B13:01	KQIPHGCVL	0.7892	0.9794	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-A02:21	KQIPHGCVL	0.7658	0.5693	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:10	KQIPHGCVL	0.7656	0.7251	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:03	KQIPHGCVL	0.7644	0.8626	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B35:03	LPHEKDKQI	0.7595	0.7757	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:25	KQIPHGCVL	0.7549	0.9539	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B35:04	LPHEKDKQI	0.7418	0.8852	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B35:02	LPHEKDKQI	0.7418	0.8852	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:18	KQIPHGCVL	0.6941	0.7855	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B47:01	KQIPHGCVL	0.6618	0.6172	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B07:10	KQIPHGCVL	0.5256	0.6656	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:37	KQIPHGCVL	0.4674	0.7312	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B52:01	KQIPHGCVL	0.0177	0.941	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:01	KQIPHGCVLV	0.9107	0.9123	12	22
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B13:02	KQIPHGCVLV	0.9013	0.9753	12	22
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:37	DKQIPHGCVL	0.8392	0.6306	11	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:01	KQIPHGCVLVM	1	0.9351	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:01	KQIPHGCVLVM	0.9973	0.9416	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:01	KDKQIPHGCVL	0.9939	0.7479	10	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:25	KQIPHGCVLVM	0.9933	0.9197	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:03	KQIPHGCVLVM	0.991	0.8467	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B13:01	KQIPHGCVLVM	0.9862	0.9889	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:04	KQIPHGCVL	0.9772	0.9704	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:12	KQIPHGCVL	0.9688	0.968	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:07	KQIPHGCVL	0.9665	0.8701	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:09	KQIPHGCVL	0.9647	0.9266	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-C07:13	KQIPHGCVL	0.964	0.9593	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:03	KQIPHGCVL	0.9548	0.7439	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-C07:29	KQIPHGCVL	0.9526	0.9441	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:08	KQIPHGCVL	0.9501	0.9756	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B42:02	LPHEKDKQI	0.9422	0.5871	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-C02:06	KQIPHGCVL	0.9277	0.9828	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B51:07	LPHEKDKQI	0.9207	0.8783	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B42:01	LPHEKDKQI	0.9127	0.5807	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:05	KQIPHGCVL	0.8374	0.9601	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B35:12	LPHEKDKQI	0.7418	0.8852	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-C12:16	KQIPHGCVL	0.7167	0.9838	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B14:03	KQIPHGCVL	0.6619	0.9336	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:05	KQIPHGCVL	0.342	0.9125	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:10	LPHEKDKQI	0.1914	0.9351	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:04	KQIPHGCVLV	0.9212	0.941	12	22
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:07	KQIPHGCVLVM	0.9999	0.88	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:04	KQIPHGCVLVM	0.9998	0.9514	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:05	KQIPHGCVLVM	0.971	0.8257	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:03	KQIPHGCVLVM	0.9548	0.9241	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:03	KDKQIPHGCVL	0.9539	0.6766	10	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:125	KQIPHGCVL	0.994	0.9548	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:27	KQIPHGCVL	0.994	0.9593	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:33	KQIPHGCVL	0.994	0.9548	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:34	KQIPHGCVL	0.994	0.9548	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:135	KQIPHGCVL	0.9929	0.965	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:24	KQIPHGCVL	0.9922	0.9745	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:50	KQIPHGCVL	0.9899	0.9665	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:02	KQIPHGCVL	0.9745	0.9737	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:73	KQIPHGCVL	0.9724	0.9866	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:31	KQIPHGCVL	0.9633	0.9665	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:35	KQIPHGCVL	0.9613	0.9555	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B40:12	KQIPHGCVL	0.9548	0.7439	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B27:06	KQIPHGCVL	0.9486	0.7922	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:53	KQIPHGCVL	0.9429	0.9475	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B78:02	LPHEKDKQI	0.9423	0.5541	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:68	KQIPHGCVL	0.9294	0.8252	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B51:21	LPHEKDKQI	0.9293	0.5142	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B08:18	LPHEKDKQI	0.9068	0.5756	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B40:49	KQIPHGCVL	0.9067	0.7057	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:30	KQIPHGCVL	0.9057	0.9782	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-C07:04	KQIPHGCVL	0.8961	0.9764	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B39:11	KQIPHGCVL	0.8943	0.9628	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:54	KQIPHGCVL	0.8865	0.938	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:12	KQIPHGCVL	0.8433	0.9219	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-C03:05	KQIPHGCVL	0.8414	0.9325	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B40:21	KQIPHGCVL	0.8099	0.7618	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B18:05	HEKDKQIPH	0.8068	0.6195	8	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-C12:02	KQIPHGCVL	0.8039	0.9851	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-C03:67	KQIPHGCVL	0.7988	0.9802	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B18:06	HEKDKQIPH	0.7768	0.6303	8	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-A02:14	KQIPHGCVL	0.7706	0.5371	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B18:11	HEKDKQIPH	0.7674	0.5042	8	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-A02:06	KQIPHGCVL	0.7658	0.5693	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B35:09	LPHEKDKQI	0.7418	0.8852	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:39	KQIPHGCVL	0.7395	0.9029	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:02	KQIPHGCVL	0.6875	0.9301	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B08:12	LPHEKDKQI	0.6235	0.7888	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:05	KQIPHGCVL	0.6125	0.5795	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:09	KQIPHGCVL	0.5968	0.7997	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B07:13	KQIPHGCVL	0.5151	0.9073	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:20	KQIPHGCVL	0.3624	0.9367	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B35:28	KQIPHGCVL	0.3581	0.9382	12	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B67:01	LPHEKDKQI	0.3386	0.8808	6	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:53	HEKDKQIPH	0.0975	0.6145	8	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:73	KQIPHGCVLV	0.9194	0.9835	12	22
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:33	KQIPHGCVLVM	1	0.9351	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:135	KQIPHGCVLVM	1	0.9407	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:125	KQIPHGCVLVM	1	0.9351	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:27	KQIPHGCVLVM	1	0.9537	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:34	KQIPHGCVLVM	1	0.9351	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:50	KQIPHGCVLVM	0.9999	0.9365	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:24	KQIPHGCVLVM	0.9999	0.976	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:35	KQIPHGCVLVM	0.9998	0.9561	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:53	KQIPHGCVLVM	0.9996	0.9323	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:68	KQIPHGCVLVM	0.9994	0.8153	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:73	KQIPHGCVLVM	0.9993	0.9915	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:30	KQIPHGCVLVM	0.9987	0.9877	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:54	KQIPHGCVLVM	0.9974	0.9118	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:39	KQIPHGCVLVM	0.9943	0.8904	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B40:21	KQIPHGCVLVM	0.9864	0.9418	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B15:73	KDKQIPHGCVL	0.986	0.9731	10	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:02	KQIPHGCVLVM	0.982	0.8151	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B35:28	KQIPHGCVLVM	0.9584	0.8252	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B40:12	KQIPHGCVLVM	0.9548	0.9241	12	23
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B40:12	KDKQIPHGCVL	0.9539	0.6766	10	21
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	HLA-B48:05	KQIPHGCVLVM	0.9233	0.6231	12	23

Top

Potential FusionNeoAntigen Information of KAT6A-GOT1L1 in HLA II

KAT6A-GOT1L1_41905896_37794575.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-0806	LPPVSLLPHEKDKQI	0	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-0822	LPPVSLLPHEKDKQI	0	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1103	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1141	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1148	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1159	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1159	PPVSLLPHEKDKQIP	1	16
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1163	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1176	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1185	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1304	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1304	PPVSLLPHEKDKQIP	1	16
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1308	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1309	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1324	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1327	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1327	PPVSLLPHEKDKQIP	1	16
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1332	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1332	PPVSLLPHEKDKQIP	1	16
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1348	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1348	PPVSLLPHEKDKQIP	1	16
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1358	LPPVSLLPHEKDKQI	0	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1370	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1371	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1371	PPVSLLPHEKDKQIP	1	16
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1372	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1375	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1375	PPVSLLPHEKDKQIP	1	16
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1376	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1384	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1389	LPPVSLLPHEKDKQI	0	15
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1393	PVSLLPHEKDKQIPH	2	17
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1393	PPVSLLPHEKDKQIP	1	16
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1012	DRB1-1437	PVSLLPHEKDKQIPH	2	17

Top

Fusion breakpoint peptide structures of KAT6A-GOT1L1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5390	LPHEKDKQIPHGCV	KAT6A	GOT1L1	chr8	41905896	chr8	37794575	1012

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KAT6A-GOT1L1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5390	LPHEKDKQIPHGCV	-7.37157	-7.48337
HLA-B14:02	3BVN	5390	LPHEKDKQIPHGCV	-5.75216	-6.79526
HLA-B52:01	3W39	5390	LPHEKDKQIPHGCV	-7.36854	-7.48034
HLA-B52:01	3W39	5390	LPHEKDKQIPHGCV	-4.42371	-5.46681
HLA-A11:01	4UQ2	5390	LPHEKDKQIPHGCV	-8.60667	-9.64977
HLA-A11:01	4UQ2	5390	LPHEKDKQIPHGCV	-5.54504	-5.65684
HLA-A24:02	5HGA	5390	LPHEKDKQIPHGCV	-7.65859	-7.77039
HLA-A24:02	5HGA	5390	LPHEKDKQIPHGCV	-6.03094	-7.07404
HLA-B44:05	3DX8	5390	LPHEKDKQIPHGCV	-5.82315	-5.93495
HLA-B44:05	3DX8	5390	LPHEKDKQIPHGCV	-2.98805	-4.03115

Top

Vaccine Design for the FusionNeoAntigens of KAT6A-GOT1L1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	10	21	KDKQIPHGCVL	AAGGATAAGCAGATCCCACATGGCTGTGTCCTT
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	11	21	DKQIPHGCVL	GATAAGCAGATCCCACATGGCTGTGTCCTT
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	12	21	KQIPHGCVL	AAGCAGATCCCACATGGCTGTGTCCTT
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	12	22	KQIPHGCVLV	AAGCAGATCCCACATGGCTGTGTCCTTGTG
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	12	23	KQIPHGCVLVM	AAGCAGATCCCACATGGCTGTGTCCTTGTGATG
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	6	15	LPHEKDKQI	CTTCCACATGAAAAGGATAAGCAGATC
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	8	17	HEKDKQIPH	CATGAAAAGGATAAGCAGATCCCACAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	0	15	LPPVSLLPHEKDKQI	TTACCTCCAGTGTCCCTTCTTCCACATGAAAAGGATAAGCAGATC
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	1	16	PPVSLLPHEKDKQIP	CCTCCAGTGTCCCTTCTTCCACATGAAAAGGATAAGCAGATCCCA
KAT6A-GOT1L1	chr8	41905896	chr8	37794575	2	17	PVSLLPHEKDKQIPH	CCAGTGTCCCTTCTTCCACATGAAAAGGATAAGCAGATCCCACAT

Top

Information of the samples that have these potential fusion neoantigens of KAT6A-GOT1L1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	KAT6A-GOT1L1	chr8	41905896	ENST00000265713	chr8	37794575	ENST00000307599	TCGA-69-8255-01A

Top

Potential target of CAR-T therapy development for KAT6A-GOT1L1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KAT6A-GOT1L1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KAT6A-GOT1L1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	KAT6A	C4225396	MENTAL RETARDATION, AUTOSOMAL DOMINANT 32	3	CTD_human;GENOMICS_ENGLAND;ORPHANET
Hgene	KAT6A	C4511003	Acute myeloid leukemia with t(8;16)(p11;p13) translocation	2	ORPHANET
Hgene	KAT6A	C0010606	Adenoid Cystic Carcinoma	1	CTD_human
Hgene	KAT6A	C0025149	Medulloblastoma	1	CTD_human
Hgene	KAT6A	C0033578	Prostatic Neoplasms	1	CTD_human
Hgene	KAT6A	C0205833	Medullomyoblastoma	1	CTD_human
Hgene	KAT6A	C0278510	Childhood Medulloblastoma	1	CTD_human
Hgene	KAT6A	C0278876	Adult Medulloblastoma	1	CTD_human
Hgene	KAT6A	C0376358	Malignant neoplasm of prostate	1	CTD_human
Hgene	KAT6A	C0751291	Desmoplastic Medulloblastoma	1	CTD_human
Hgene	KAT6A	C1275668	Melanotic medulloblastoma	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)