Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KDM3A-LTBP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KDM3A-LTBP1
	FusionPDB ID: 41762
	FusionGDB2.0 ID: 41762
		Hgene	Tgene
	Gene symbol	KDM3A	LTBP1
	Gene ID	55818	4052
	Gene name	lysine demethylase 3A	latent transforming growth factor beta binding protein 1
	Synonyms	JHDM2A\|JHMD2A\|JMJD1\|JMJD1A\|TSGA	-
	Cytomap	2p11.2	2p22.3
	Type of gene	protein-coding	protein-coding
	Description	lysine-specific demethylase 3AjmjC domain-containing histone demethylation protein 2Ajumonji C domain-containing histone demethylase 2Ajumonji domain-containing protein 1Alysine (K)-specific demethylase 3Atestis-specific protein A	latent-transforming growth factor beta-binding protein 1LTBP-1TGF-beta1-BP-1transforming growth factor beta-1-binding protein 1
	Modification date	20200313	20200329
	UniProtAcc	Q9Y4C1 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-9' of histone H3, thereby playing a central role in histone code. Preferentially demethylates mono- and dimethylated H3 'Lys-9' residue, with a preference for dimethylated residue, while it has weak or no activity on trimethylated H3 'Lys-9'. Demethylation of Lys residue generates formaldehyde and succinate. Involved in hormone-dependent transcriptional activation, by participating in recruitment to androgen-receptor target genes, resulting in H3 'Lys-9' demethylation and transcriptional activation. Involved in spermatogenesis by regulating expression of target genes such as PRM1 and TNP1 which are required for packaging and condensation of sperm chromatin. Involved in obesity resistance through regulation of metabolic genes such as PPARA and UCP1. {ECO:0000269\|PubMed:16603237, ECO:0000269\|PubMed:28262558}.	Q14766 Main function of 5'-partner protein: FUNCTION: Key regulator of transforming growth factor beta (TGFB1, TGFB2 and TGFB3) that controls TGF-beta activation by maintaining it in a latent state during storage in extracellular space (PubMed:2022183, PubMed:8617200, PubMed:8939931). Associates specifically via disulfide bonds with the Latency-associated peptide (LAP), which is the regulatory chain of TGF-beta, and regulates integrin-dependent activation of TGF-beta (PubMed:8617200, PubMed:8939931, PubMed:15184403). Outcompeted by LRRC32/GARP for binding to LAP regulatory chain of TGF-beta (PubMed:22278742). {ECO:0000269\|PubMed:15184403, ECO:0000269\|PubMed:2022183, ECO:0000269\|PubMed:22278742, ECO:0000269\|PubMed:8617200, ECO:0000269\|PubMed:8939931}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000312912, ENST00000409064, ENST00000409556, ENST00000542128, ENST00000485171,	ENST00000498013, ENST00000272273, ENST00000354476, ENST00000390003, ENST00000402934, ENST00000404525, ENST00000404816, ENST00000407925, ENST00000418533,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 12 X 7=1092	13 X 14 X 6=1092
	# samples	15	14
	** MAII score	log2(15/1092*10)=-2.86393845042397 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/1092*10)=-2.96347412397489 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KDM3A [Title/Abstract] AND LTBP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KDM3A [Title/Abstract] AND LTBP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KDM3A(86694006)-LTBP1(33614251), # samples:2
Anticipated loss of major functional domain due to fusion event.	KDM3A-LTBP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM3A-LTBP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM3A-LTBP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KDM3A-LTBP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	KDM3A	GO:0009755	hormone-mediated signaling pathway	16603237
Hgene	KDM3A	GO:0030521	androgen receptor signaling pathway	16603237
Hgene	KDM3A	GO:0033169	histone H3-K9 demethylation	16603237
Hgene	KDM3A	GO:0046293	formaldehyde biosynthetic process	16603237
Tgene	LTBP1	GO:0035583	sequestering of TGFbeta in extracellular matrix	2022183\|8617200
Tgene	LTBP1	GO:1901388	regulation of transforming growth factor beta activation	2022183\|8617200

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:86694006/chr2:33614251)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KDM3A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LTBP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000404816	LTBP1	chr2	33614251	+	3153	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000354476	LTBP1	chr2	33614251	+	3300	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000390003	LTBP1	chr2	33614251	+	3300	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000418533	LTBP1	chr2	33614251	+	3300	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000402934	LTBP1	chr2	33614251	+	3151	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000404525	LTBP1	chr2	33614251	+	3303	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000407925	LTBP1	chr2	33614251	+	3157	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000272273	LTBP1	chr2	33614251	+	2482	1884	365	2338	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000404816	LTBP1	chr2	33614251	+	3115	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000354476	LTBP1	chr2	33614251	+	3262	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000390003	LTBP1	chr2	33614251	+	3262	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000418533	LTBP1	chr2	33614251	+	3262	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000402934	LTBP1	chr2	33614251	+	3113	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000404525	LTBP1	chr2	33614251	+	3265	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000407925	LTBP1	chr2	33614251	+	3119	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000272273	LTBP1	chr2	33614251	+	2444	1846	327	2300	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000404816	LTBP1	chr2	33614251	+	2846	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000354476	LTBP1	chr2	33614251	+	2993	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000390003	LTBP1	chr2	33614251	+	2993	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000418533	LTBP1	chr2	33614251	+	2993	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000402934	LTBP1	chr2	33614251	+	2844	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000404525	LTBP1	chr2	33614251	+	2996	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000407925	LTBP1	chr2	33614251	+	2850	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000272273	LTBP1	chr2	33614251	+	2175	1577	58	2031	657
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000404816	LTBP1	chr2	33614251	+	2632	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000354476	LTBP1	chr2	33614251	+	2779	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000390003	LTBP1	chr2	33614251	+	2779	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000418533	LTBP1	chr2	33614251	+	2779	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000402934	LTBP1	chr2	33614251	+	2630	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000404525	LTBP1	chr2	33614251	+	2782	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000407925	LTBP1	chr2	33614251	+	2636	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000272273	LTBP1	chr2	33614251	+	1961	1363	0	1817	605
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000404816	LTBP1	chr2	33614250	+	3153	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000354476	LTBP1	chr2	33614250	+	3300	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000390003	LTBP1	chr2	33614250	+	3300	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000418533	LTBP1	chr2	33614250	+	3300	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000402934	LTBP1	chr2	33614250	+	3151	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000404525	LTBP1	chr2	33614250	+	3303	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000407925	LTBP1	chr2	33614250	+	3157	1884	365	2338	657
ENST00000409556	KDM3A	chr2	86694006	+	ENST00000272273	LTBP1	chr2	33614250	+	2482	1884	365	2338	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000404816	LTBP1	chr2	33614250	+	3115	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000354476	LTBP1	chr2	33614250	+	3262	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000390003	LTBP1	chr2	33614250	+	3262	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000418533	LTBP1	chr2	33614250	+	3262	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000402934	LTBP1	chr2	33614250	+	3113	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000404525	LTBP1	chr2	33614250	+	3265	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000407925	LTBP1	chr2	33614250	+	3119	1846	327	2300	657
ENST00000312912	KDM3A	chr2	86694006	+	ENST00000272273	LTBP1	chr2	33614250	+	2444	1846	327	2300	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000404816	LTBP1	chr2	33614250	+	2846	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000354476	LTBP1	chr2	33614250	+	2993	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000390003	LTBP1	chr2	33614250	+	2993	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000418533	LTBP1	chr2	33614250	+	2993	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000402934	LTBP1	chr2	33614250	+	2844	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000404525	LTBP1	chr2	33614250	+	2996	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000407925	LTBP1	chr2	33614250	+	2850	1577	58	2031	657
ENST00000409064	KDM3A	chr2	86694006	+	ENST00000272273	LTBP1	chr2	33614250	+	2175	1577	58	2031	657
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000404816	LTBP1	chr2	33614250	+	2632	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000354476	LTBP1	chr2	33614250	+	2779	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000390003	LTBP1	chr2	33614250	+	2779	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000418533	LTBP1	chr2	33614250	+	2779	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000402934	LTBP1	chr2	33614250	+	2630	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000404525	LTBP1	chr2	33614250	+	2782	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000407925	LTBP1	chr2	33614250	+	2636	1363	0	1817	605
ENST00000542128	KDM3A	chr2	86694006	+	ENST00000272273	LTBP1	chr2	33614250	+	1961	1363	0	1817	605

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000409556	ENST00000404816	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000737513	0.9992625
ENST00000409556	ENST00000354476	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000591933	0.9994081
ENST00000409556	ENST00000390003	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000591933	0.9994081
ENST00000409556	ENST00000418533	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000591933	0.9994081
ENST00000409556	ENST00000402934	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.00072805	0.9992719
ENST00000409556	ENST00000404525	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000594694	0.99940526
ENST00000409556	ENST00000407925	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000734404	0.9992656
ENST00000409556	ENST00000272273	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.001876544	0.99812347
ENST00000312912	ENST00000404816	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000618222	0.9993818
ENST00000312912	ENST00000354476	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000502679	0.9994973
ENST00000312912	ENST00000390003	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000502679	0.9994973
ENST00000312912	ENST00000418533	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000502679	0.9994973
ENST00000312912	ENST00000402934	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000609004	0.99939096
ENST00000312912	ENST00000404525	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.0005047	0.99949527
ENST00000312912	ENST00000407925	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000612408	0.9993876
ENST00000312912	ENST00000272273	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.00157798	0.998422
ENST00000409064	ENST00000404816	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000588814	0.9994112
ENST00000409064	ENST00000354476	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000470402	0.9995296
ENST00000409064	ENST00000390003	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000470402	0.9995296
ENST00000409064	ENST00000418533	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000470402	0.9995296
ENST00000409064	ENST00000402934	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000580709	0.99941933
ENST00000409064	ENST00000404525	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000471576	0.9995284
ENST00000409064	ENST00000407925	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000586112	0.99941385
ENST00000409064	ENST00000272273	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.00150432	0.9984957
ENST00000542128	ENST00000404816	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000307033	0.99969304
ENST00000542128	ENST00000354476	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000223903	0.99977607
ENST00000542128	ENST00000390003	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000223903	0.99977607
ENST00000542128	ENST00000418533	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000223903	0.99977607
ENST00000542128	ENST00000402934	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000302355	0.9996977
ENST00000542128	ENST00000404525	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000224518	0.99977547
ENST00000542128	ENST00000407925	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.000305265	0.9996947
ENST00000542128	ENST00000272273	KDM3A	chr2	86694006	+	LTBP1	chr2	33614251	+	0.001015033	0.998985
ENST00000409556	ENST00000404816	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000737513	0.9992625
ENST00000409556	ENST00000354476	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000591933	0.9994081
ENST00000409556	ENST00000390003	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000591933	0.9994081
ENST00000409556	ENST00000418533	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000591933	0.9994081
ENST00000409556	ENST00000402934	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.00072805	0.9992719
ENST00000409556	ENST00000404525	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000594694	0.99940526
ENST00000409556	ENST00000407925	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000734404	0.9992656
ENST00000409556	ENST00000272273	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.001876544	0.99812347
ENST00000312912	ENST00000404816	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000618222	0.9993818
ENST00000312912	ENST00000354476	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000502679	0.9994973
ENST00000312912	ENST00000390003	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000502679	0.9994973
ENST00000312912	ENST00000418533	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000502679	0.9994973
ENST00000312912	ENST00000402934	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000609004	0.99939096
ENST00000312912	ENST00000404525	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.0005047	0.99949527
ENST00000312912	ENST00000407925	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000612408	0.9993876
ENST00000312912	ENST00000272273	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.00157798	0.998422
ENST00000409064	ENST00000404816	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000588814	0.9994112
ENST00000409064	ENST00000354476	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000470402	0.9995296
ENST00000409064	ENST00000390003	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000470402	0.9995296
ENST00000409064	ENST00000418533	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000470402	0.9995296
ENST00000409064	ENST00000402934	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000580709	0.99941933
ENST00000409064	ENST00000404525	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000471576	0.9995284
ENST00000409064	ENST00000407925	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000586112	0.99941385
ENST00000409064	ENST00000272273	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.00150432	0.9984957
ENST00000542128	ENST00000404816	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000307033	0.99969304
ENST00000542128	ENST00000354476	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000223903	0.99977607
ENST00000542128	ENST00000390003	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000223903	0.99977607
ENST00000542128	ENST00000418533	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000223903	0.99977607
ENST00000542128	ENST00000402934	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000302355	0.9996977
ENST00000542128	ENST00000404525	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000224518	0.99977547
ENST00000542128	ENST00000407925	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.000305265	0.9996947
ENST00000542128	ENST00000272273	KDM3A	chr2	86694006	+	LTBP1	chr2	33614250	+	0.001015033	0.998985

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KDM3A-LTBP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KDM3A	chr2	86694006	LTBP1	chr2	33614250	1363	454	ESCCSRSNNKIQNDDYAQLCNIPVTG
KDM3A	chr2	86694006	LTBP1	chr2	33614250	1577	506	ESCCSRSNNKIQNDDYAQLCNIPVTG
KDM3A	chr2	86694006	LTBP1	chr2	33614250	1846	506	ESCCSRSNNKIQNDDYAQLCNIPVTG
KDM3A	chr2	86694006	LTBP1	chr2	33614250	1884	506	ESCCSRSNNKIQNDDYAQLCNIPVTG
KDM3A	chr2	86694006	LTBP1	chr2	33614251	1363	454	ESCCSRSNNKIQNDDYAQLCNIPVTG
KDM3A	chr2	86694006	LTBP1	chr2	33614251	1577	506	ESCCSRSNNKIQNDDYAQLCNIPVTG
KDM3A	chr2	86694006	LTBP1	chr2	33614251	1846	506	ESCCSRSNNKIQNDDYAQLCNIPVTG
KDM3A	chr2	86694006	LTBP1	chr2	33614251	1884	506	ESCCSRSNNKIQNDDYAQLCNIPVTG

Top

Potential FusionNeoAntigen Information of KDM3A-LTBP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KDM3A-LTBP1_86694006_33614250.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B48:01	IQNDDYAQL	0.9691	0.5254	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-A02:22	IQNDDYAQL	0.9609	0.6247	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-A02:21	IQNDDYAQL	0.9046	0.8171	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B39:01	IQNDDYAQL	0.8652	0.9657	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B39:13	IQNDDYAQL	0.7687	0.975	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B38:01	IQNDDYAQL	0.7505	0.9742	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B38:02	IQNDDYAQL	0.7433	0.9797	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:03	IQNDDYAQL	0.7009	0.7678	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B13:02	IQNDDYAQL	0.6335	0.6261	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B13:01	IQNDDYAQL	0.6037	0.9045	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:10	IQNDDYAQL	0.5893	0.5782	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:37	IQNDDYAQL	0.5031	0.705	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B47:01	IQNDDYAQL	0.492	0.6185	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B52:01	IQNDDYAQL	0.0999	0.9548	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B13:01	KIQNDDYAQL	0.3257	0.92	9	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:04	IQNDDYAQL	0.9321	0.8733	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C08:03	IQNDDYAQL	0.9201	0.9909	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B39:09	IQNDDYAQL	0.8955	0.8217	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C08:04	IQNDDYAQL	0.8917	0.9796	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C08:13	IQNDDYAQL	0.8917	0.9796	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C07:13	IQNDDYAQL	0.8501	0.9132	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C07:29	IQNDDYAQL	0.8389	0.9663	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B39:08	IQNDDYAQL	0.754	0.9347	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C02:06	IQNDDYAQL	0.7094	0.9829	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B39:05	IQNDDYAQL	0.7092	0.9617	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:05	IQNDDYAQL	0.4014	0.8552	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:24	IQNDDYAQL	0.9696	0.8906	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:53	IQNDDYAQL	0.9542	0.8679	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C08:01	IQNDDYAQL	0.9201	0.9909	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:73	IQNDDYAQL	0.9114	0.8978	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-A02:14	IQNDDYAQL	0.9107	0.7853	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-A02:06	IQNDDYAQL	0.9046	0.8171	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C17:01	IQNDDYAQL	0.8846	0.9237	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B39:02	IQNDDYAQL	0.8839	0.9747	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B39:31	IQNDDYAQL	0.8811	0.966	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:30	IQNDDYAQL	0.853	0.8556	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:54	IQNDDYAQL	0.8468	0.8433	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:12	IQNDDYAQL	0.7987	0.9136	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-C07:04	IQNDDYAQL	0.7682	0.9547	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B38:05	IQNDDYAQL	0.7505	0.9742	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B39:11	IQNDDYAQL	0.7216	0.8997	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B48:02	IQNDDYAQL	0.5587	0.8953	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:20	IQNDDYAQL	0.4363	0.902	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:09	IQNDDYAQL	0.4363	0.5589	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B35:28	IQNDDYAQL	0.4179	0.9023	10	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:73	KIQNDDYAQL	0.964	0.9559	9	19
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	HLA-B15:30	KIQNDDYAQL	0.9483	0.9237	9	19

Top

Potential FusionNeoAntigen Information of KDM3A-LTBP1 in HLA II

KDM3A-LTBP1_86694006_33614250.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1601	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1602	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1603	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1605	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1607	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1608	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1611	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1612	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1614	QNDDYAQLCNIPVTG	11	26
KDM3A-LTBP1	chr2	86694006	chr2	33614250	1846	DRB1-1616	QNDDYAQLCNIPVTG	11	26

Top

Fusion breakpoint peptide structures of KDM3A-LTBP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8861	SNNKIQNDDYAQLC	KDM3A	LTBP1	chr2	86694006	chr2	33614250	1846

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KDM3A-LTBP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8861	SNNKIQNDDYAQLC	-7.9962	-8.1096
HLA-B14:02	3BVN	8861	SNNKIQNDDYAQLC	-5.70842	-6.74372
HLA-B52:01	3W39	8861	SNNKIQNDDYAQLC	-6.83737	-6.95077
HLA-B52:01	3W39	8861	SNNKIQNDDYAQLC	-4.4836	-5.5189
HLA-A11:01	4UQ2	8861	SNNKIQNDDYAQLC	-10.0067	-10.1201
HLA-A11:01	4UQ2	8861	SNNKIQNDDYAQLC	-9.03915	-10.0745
HLA-A24:02	5HGA	8861	SNNKIQNDDYAQLC	-6.56204	-6.67544
HLA-A24:02	5HGA	8861	SNNKIQNDDYAQLC	-5.42271	-6.45801
HLA-B44:05	3DX8	8861	SNNKIQNDDYAQLC	-7.85648	-8.89178
HLA-B44:05	3DX8	8861	SNNKIQNDDYAQLC	-5.3978	-5.5112
HLA-A02:01	6TDR	8861	SNNKIQNDDYAQLC	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of KDM3A-LTBP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KDM3A-LTBP1	chr2	86694006	chr2	33614250	10	19	IQNDDYAQL	TCCAGAATGATGACTATGCTCAGCTGT
KDM3A-LTBP1	chr2	86694006	chr2	33614250	9	19	KIQNDDYAQL	AAATCCAGAATGATGACTATGCTCAGCTGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
KDM3A-LTBP1	chr2	86694006	chr2	33614250	11	26	QNDDYAQLCNIPVTG	AGAATGATGACTATGCTCAGCTGTGTAACATCCCCGTGACGGGAC

Top

Information of the samples that have these potential fusion neoantigens of KDM3A-LTBP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	KDM3A-LTBP1	chr2	86694006	ENST00000312912	chr2	33614250	ENST00000272273	TCGA-13-0801

Top

Potential target of CAR-T therapy development for KDM3A-LTBP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KDM3A-LTBP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KDM3A-LTBP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)