Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KDM4B-RNF126

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KDM4B-RNF126
	FusionPDB ID: 41814
	FusionGDB2.0 ID: 41814
		Hgene	Tgene
	Gene symbol	KDM4B	RNF126
	Gene ID	23030	55658
	Gene name	lysine demethylase 4B	ring finger protein 126
	Synonyms	JMJD2B\|TDRD14B	-
	Cytomap	19p13.3	19p13.3
	Type of gene	protein-coding	protein-coding
	Description	lysine-specific demethylase 4BjmjC domain-containing histone demethylation protein 3Bjumonji domain containing 2Bjumonji domain-containing protein 2Blysine (K)-specific demethylase 4Btudor domain containing 14B	E3 ubiquitin-protein ligase RNF126
	Modification date	20200313	20200320
	UniProtAcc	O94953 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-9' of histone H3, thereby playing a role in histone code. Does not demethylate histone H3 'Lys-4', H3 'Lys-27', H3 'Lys-36' nor H4 'Lys-20'. Only able to demethylate trimethylated H3 'Lys-9', with a weaker activity than KDM4A, KDM4C and KDM4D. Demethylation of Lys residue generates formaldehyde and succinate. {ECO:0000269\|PubMed:16603238, ECO:0000269\|PubMed:28262558}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000159111, ENST00000536461, ENST00000381759, ENST00000592175,	ENST00000292363,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	30 X 16 X 14=6720	8 X 3 X 6=144
	# samples	38	9
	** MAII score	log2(38/6720*10)=-4.14438990933518 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/144*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KDM4B [Title/Abstract] AND RNF126 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KDM4B [Title/Abstract] AND RNF126 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KDM4B(5144913)-RNF126(652884), # samples:2
Anticipated loss of major functional domain due to fusion event.	KDM4B-RNF126 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4B-RNF126 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4B-RNF126 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4B-RNF126 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	KDM4B	GO:0033169	histone H3-K9 demethylation	21914792
Hgene	KDM4B	GO:0070544	histone H3-K36 demethylation	21914792
Tgene	RNF126	GO:0006511	ubiquitin-dependent protein catabolic process	24981174
Tgene	RNF126	GO:0006513	protein monoubiquitination	23277564
Tgene	RNF126	GO:0043161	proteasome-mediated ubiquitin-dependent protein catabolic process	24981174

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:5144913/chr19:652884)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KDM4B (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RNF126 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000159111

KDM4B

chr19

5144913

ENST00000292363

RNF126

chr19

652884

4702

3239

218

4099

1293

ENST00000536461

KDM4B

chr19

5144913

ENST00000292363

RNF126

chr19

652884

4626

3163

4023

1327

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000159111	ENST00000292363	KDM4B	chr19	5144913	+	RNF126	chr19	652884	-	0.004037127	0.9959629
ENST00000536461	ENST00000292363	KDM4B	chr19	5144913	+	RNF126	chr19	652884	-	0.002848456	0.99715155

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KDM4B-RNF126

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KDM4B	chr19	5144913	RNF126	chr19	652884	3163	1040	KAKFISSVTSHIYQDYICPRCESGFI
KDM4B	chr19	5144913	RNF126	chr19	652884	3239	1006	KAKFISSVTSHIYQDYICPRCESGFI

Top

Potential FusionNeoAntigen Information of KDM4B-RNF126 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KDM4B-RNF126_5144913_652884.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	HLA-B39:06	SHIYQDYIC	0.9765	0.5072	9	18
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	HLA-B15:17	VTSHIYQDY	0.9629	0.8001	7	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	HLA-A31:02	IYQDYICPR	0.9473	0.6751	11	20
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	HLA-B39:05	SHIYQDYIC	0.9576	0.6307	9	18
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	HLA-A31:01	IYQDYICPR	0.9544	0.6729	11	20
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	HLA-C15:04	VTSHIYQDY	0.6704	0.7268	7	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	HLA-B57:04	VTSHIYQDY	0.9533	0.598	7	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	HLA-C15:09	VTSHIYQDY	0.6704	0.7268	7	16

Top

Potential FusionNeoAntigen Information of KDM4B-RNF126 in HLA II

KDM4B-RNF126_5144913_652884.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0113	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0117	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0121	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0338	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0469	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0469	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0474	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0482	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0701	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0703	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0704	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0704	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0705	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0706	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0707	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0708	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0709	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0711	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0712	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0713	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0714	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0715	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0716	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0717	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0719	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0807	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0819	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0825	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0825	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0834	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0901	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0901	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0902	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0902	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0903	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0903	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0904	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0904	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0905	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0905	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0906	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0907	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0907	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0908	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0909	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-0909	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1201	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1201	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1201	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1203	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1203	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1204	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1204	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1205	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1205	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1205	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1206	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1206	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1206	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1207	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1207	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1207	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1208	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1208	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1208	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1209	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1209	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1210	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1210	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1210	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1211	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1211	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1211	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1212	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1212	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1212	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1213	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1213	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1214	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1214	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1214	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1215	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1215	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1216	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1217	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1217	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1217	KFISSVTSHIYQDYI	2	17
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1218	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1218	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1219	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1219	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1221	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1221	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1222	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1222	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1223	AKFISSVTSHIYQDY	1	16
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1223	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1331	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1367	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1407	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1410	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1414	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1436	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1442	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1444	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1446	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1448	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1449	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1451	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1468	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1489	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1493	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1604	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB1-1614	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0109	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0202	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0205	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0209	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0210	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0211	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0212	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0213	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0215	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0216	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0217	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0218	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0219	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0220	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0221	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0222	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0223	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0225	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB3-0303	KAKFISSVTSHIYQD	0	15
KDM4B-RNF126	chr19	5144913	chr19	652884	3239	DRB5-0112	KAKFISSVTSHIYQD	0	15

Top

Fusion breakpoint peptide structures of KDM4B-RNF126

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9169	SVTSHIYQDYICPR	KDM4B	RNF126	chr19	5144913	chr19	652884	3239

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KDM4B-RNF126

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9169	SVTSHIYQDYICPR	-7.9962	-8.1096
HLA-B14:02	3BVN	9169	SVTSHIYQDYICPR	-5.70842	-6.74372
HLA-B52:01	3W39	9169	SVTSHIYQDYICPR	-6.83737	-6.95077
HLA-B52:01	3W39	9169	SVTSHIYQDYICPR	-4.4836	-5.5189
HLA-A11:01	4UQ2	9169	SVTSHIYQDYICPR	-10.0067	-10.1201
HLA-A11:01	4UQ2	9169	SVTSHIYQDYICPR	-9.03915	-10.0745
HLA-A24:02	5HGA	9169	SVTSHIYQDYICPR	-6.56204	-6.67544
HLA-A24:02	5HGA	9169	SVTSHIYQDYICPR	-5.42271	-6.45801
HLA-B44:05	3DX8	9169	SVTSHIYQDYICPR	-7.85648	-8.89178
HLA-B44:05	3DX8	9169	SVTSHIYQDYICPR	-5.3978	-5.5112
HLA-A02:01	6TDR	9169	SVTSHIYQDYICPR	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of KDM4B-RNF126

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KDM4B-RNF126	chr19	5144913	chr19	652884	11	20	IYQDYICPR	TACCAGGATTATATCTGTCCAAGATGC
KDM4B-RNF126	chr19	5144913	chr19	652884	7	16	VTSHIYQDY	ACCAGCCACATCTACCAGGATTATATC
KDM4B-RNF126	chr19	5144913	chr19	652884	9	18	SHIYQDYIC	CACATCTACCAGGATTATATCTGTCCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
KDM4B-RNF126	chr19	5144913	chr19	652884	0	15	KAKFISSVTSHIYQD	GCCAAGTTCATCTCCTCCGTCACCAGCCACATCTACCAGGATTAT
KDM4B-RNF126	chr19	5144913	chr19	652884	1	16	AKFISSVTSHIYQDY	AAGTTCATCTCCTCCGTCACCAGCCACATCTACCAGGATTATATC
KDM4B-RNF126	chr19	5144913	chr19	652884	2	17	KFISSVTSHIYQDYI	TTCATCTCCTCCGTCACCAGCCACATCTACCAGGATTATATCTGT

Top

Information of the samples that have these potential fusion neoantigens of KDM4B-RNF126

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	KDM4B-RNF126	chr19	5144913	ENST00000159111	chr19	652884	ENST00000292363	TCGA-L5-A43C

Top

Potential target of CAR-T therapy development for KDM4B-RNF126

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KDM4B-RNF126

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KDM4B-RNF126

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)