![]() |
|||||||
|
Fusion Protein:KHDRBS3-PACRG |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: KHDRBS3-PACRG | FusionPDB ID: 41975 | FusionGDB2.0 ID: 41975 | Hgene | Tgene | Gene symbol | KHDRBS3 | PACRG | Gene ID | 10656 | 135138 |
Gene name | KH RNA binding domain containing, signal transduction associated 3 | parkin coregulated | |
Synonyms | Etle|SALP|SLM-2|SLM2|T-STAR|TSTAR|etoile | GLUP|HAK005771|PACRG2.1|PARK2CRG | |
Cytomap | 8q24.23 | 6q26 | |
Type of gene | protein-coding | protein-coding | |
Description | KH domain-containing, RNA-binding, signal transduction-associated protein 3KH domain containing, RNA binding, signal transduction associated 3RNA-binding protein T-StarSam68-like phosphotyrosine protein, T-STARsam68-like mammalian protein 2 | parkin coregulated gene proteinPARK2 co-regulatedPARK2 coregulatedmolecular chaperone/chaperonin-binding proteinparkin co-regulated gene protein | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | O75525 Main function of 5'-partner protein: FUNCTION: RNA-binding protein that plays a role in the regulation of alternative splicing and influences mRNA splice site selection and exon inclusion. Binds preferentially to the 5'-[AU]UAAA-3' motif in vitro. Binds optimally to RNA containing 5'-[AU]UAA-3' as a bipartite motif spaced by more than 15 nucleotides. Binds poly(A). RNA-binding abilities are down-regulated by tyrosine kinase PTK6 (PubMed:10564820, PubMed:19561594, PubMed:26758068). Involved in splice site selection of vascular endothelial growth factor (PubMed:15901763). In vitro regulates CD44 alternative splicing by direct binding to purine-rich exonic enhancer (By similarity). Can regulate alternative splicing of neurexins NRXN1-3 in the laminin G-like domain 6 containing the evolutionary conserved neurexin alternative spliced segment 4 (AS4) involved in neurexin selective targeting to postsynaptic partners such as neuroligins and LRRTM family members (PubMed:26758068). Targeted, cell-type specific splicing regulation of NRXN1 at AS4 is involved in neuronal glutamatergic synapse function and plasticity (By similarity). May regulate expression of KHDRBS2/SLIM-1 in defined brain neuron populations by modifying its alternative splicing (By similarity). Can bind FABP9 mRNA (By similarity). May play a role as a negative regulator of cell growth. Inhibits cell proliferation. {ECO:0000250|UniProtKB:Q9JLP1, ECO:0000250|UniProtKB:Q9R226, ECO:0000269|PubMed:10564820, ECO:0000269|PubMed:15901763, ECO:0000269|PubMed:19561594, ECO:0000269|PubMed:26758068}.; FUNCTION: (Microbial infection) Involved in post-transcriptional regulation of HIV-1 gene expression. {ECO:0000269|PubMed:11741900}. | PACRGL Main function of 5'-partner protein: 248 | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000355849, ENST00000520981, ENST00000522578, | ENST00000542669, ENST00000337019, ENST00000366888, ENST00000366889, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 7 X 5 X 4=140 | 13 X 11 X 13=1859 |
# samples | 7 | 19 | |
** MAII score | log2(7/140*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(19/1859*10)=-3.29045544658853 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: KHDRBS3 [Title/Abstract] AND PACRG [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: KHDRBS3 [Title/Abstract] AND PACRG [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | KHDRBS3(136555013)-PACRG(163483182), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | KHDRBS3-PACRG seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KHDRBS3-PACRG seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:136555013/chr6:163483182) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000355849 | KHDRBS3 | chr8 | 136555013 | + | ENST00000337019 | PACRG | chr6 | 163483182 | + | 1838 | 734 | 50 | 1333 | 427 |
ENST00000355849 | KHDRBS3 | chr8 | 136555013 | + | ENST00000366889 | PACRG | chr6 | 163483182 | + | 1722 | 734 | 50 | 1216 | 388 |
ENST00000355849 | KHDRBS3 | chr8 | 136555013 | + | ENST00000366888 | PACRG | chr6 | 163483182 | + | 1541 | 734 | 50 | 1216 | 388 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000355849 | ENST00000337019 | KHDRBS3 | chr8 | 136555013 | + | PACRG | chr6 | 163483182 | + | 0.0019615 | 0.9980385 |
ENST00000355849 | ENST00000366889 | KHDRBS3 | chr8 | 136555013 | + | PACRG | chr6 | 163483182 | + | 0.00251175 | 0.99748826 |
ENST00000355849 | ENST00000366888 | KHDRBS3 | chr8 | 136555013 | + | PACRG | chr6 | 163483182 | + | 0.003042217 | 0.9969578 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for KHDRBS3-PACRG |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
KHDRBS3 | chr8 | 136555013 | PACRG | chr6 | 163483182 | 734 | 223 | TLTKMSILGKGSMRDKAKVEIEKLDY |
Top |
Potential FusionNeoAntigen Information of KHDRBS3-PACRG in HLA I |
![]() |
KHDRBS3-PACRG_136555013_163483182.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B39:06 | MRDKAKVEI | 0.9955 | 0.664 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B39:01 | MRDKAKVEI | 0.9944 | 0.7793 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B14:02 | MRDKAKVEI | 0.9935 | 0.7309 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B14:01 | MRDKAKVEI | 0.9935 | 0.7309 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B38:01 | MRDKAKVEI | 0.9921 | 0.9123 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B38:02 | MRDKAKVEI | 0.991 | 0.905 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B15:37 | MRDKAKVEI | 0.5362 | 0.5155 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-A31:02 | KMSILGKGSMR | 0.979 | 0.5187 | 3 | 14 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B39:12 | MRDKAKVEI | 0.9942 | 0.7827 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:05 | MRDKAKVEI | 0.9929 | 0.9352 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:95 | MRDKAKVEI | 0.9925 | 0.5737 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B39:05 | MRDKAKVEI | 0.9901 | 0.7603 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:27 | MRDKAKVEI | 0.9894 | 0.927 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:29 | MRDKAKVEI | 0.9841 | 0.8766 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:13 | MRDKAKVEI | 0.9823 | 0.8632 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:46 | MRDKAKVEI | 0.9612 | 0.8306 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B73:01 | MRDKAKVEI | 0.9523 | 0.6331 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B14:03 | MRDKAKVEI | 0.6697 | 0.7593 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C12:16 | MRDKAKVEI | 0.034 | 0.9506 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-A31:01 | KMSILGKGSMR | 0.9948 | 0.5329 | 3 | 14 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B27:06 | MRDKAKVEI | 0.9977 | 0.6673 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B27:09 | MRDKAKVEI | 0.9973 | 0.7519 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B39:31 | MRDKAKVEI | 0.9955 | 0.7804 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B39:02 | MRDKAKVEI | 0.994 | 0.8358 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:01 | MRDKAKVEI | 0.9929 | 0.5012 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B38:05 | MRDKAKVEI | 0.9921 | 0.9123 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:17 | MRDKAKVEI | 0.9799 | 0.9439 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C18:01 | MRDKAKVEI | 0.9575 | 0.7788 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B15:09 | MRDKAKVEI | 0.8361 | 0.6524 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:22 | MRDKAKVEI | 0.8162 | 0.657 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C07:04 | MRDKAKVEI | 0.8146 | 0.8844 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-B39:11 | MRDKAKVEI | 0.7971 | 0.6658 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C06:08 | MRDKAKVEI | 0.7913 | 0.9841 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C06:06 | MRDKAKVEI | 0.7819 | 0.9824 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C06:17 | MRDKAKVEI | 0.1465 | 0.9906 | 12 | 21 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | HLA-C06:02 | MRDKAKVEI | 0.1465 | 0.9906 | 12 | 21 |
Top |
Potential FusionNeoAntigen Information of KHDRBS3-PACRG in HLA II |
![]() |
KHDRBS3-PACRG_136555013_163483182.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0801 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0806 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0806 | TKMSILGKGSMRDKA | 2 | 17 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0806 | LTKMSILGKGSMRDK | 1 | 16 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0810 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0810 | TKMSILGKGSMRDKA | 2 | 17 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0812 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0812 | TKMSILGKGSMRDKA | 2 | 17 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0812 | LTKMSILGKGSMRDK | 1 | 16 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0816 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0822 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0822 | TKMSILGKGSMRDKA | 2 | 17 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0822 | LTKMSILGKGSMRDK | 1 | 16 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0826 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-0839 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-1192 | LTKMSILGKGSMRDK | 1 | 16 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-1457 | KMSILGKGSMRDKAK | 3 | 18 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-1457 | TKMSILGKGSMRDKA | 2 | 17 |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 | DRB1-1478 | KMSILGKGSMRDKAK | 3 | 18 |
Top |
Fusion breakpoint peptide structures of KHDRBS3-PACRG |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3788 | ILGKGSMRDKAKVE | KHDRBS3 | PACRG | chr8 | 136555013 | chr6 | 163483182 | 734 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KHDRBS3-PACRG |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 3788 | ILGKGSMRDKAKVE | -7.81973 | -8.02863 |
HLA-B14:02 | 3BVN | 3788 | ILGKGSMRDKAKVE | -7.79354 | -8.00244 |
HLA-B14:02 | 3BVN | 3788 | ILGKGSMRDKAKVE | -7.20456 | -7.92356 |
HLA-B14:02 | 3BVN | 3788 | ILGKGSMRDKAKVE | -7.02192 | -7.74092 |
HLA-B52:01 | 3W39 | 3788 | ILGKGSMRDKAKVE | -7.1875 | -7.3964 |
HLA-B52:01 | 3W39 | 3788 | ILGKGSMRDKAKVE | -6.64731 | -6.85621 |
HLA-B52:01 | 3W39 | 3788 | ILGKGSMRDKAKVE | -5.94672 | -6.66572 |
HLA-B52:01 | 3W39 | 3788 | ILGKGSMRDKAKVE | -5.7691 | -6.4881 |
HLA-A11:01 | 4UQ2 | 3788 | ILGKGSMRDKAKVE | -11.8065 | -12.0154 |
HLA-A11:01 | 4UQ2 | 3788 | ILGKGSMRDKAKVE | -10.3631 | -10.572 |
HLA-A11:01 | 4UQ2 | 3788 | ILGKGSMRDKAKVE | -5.74401 | -6.46301 |
HLA-A11:01 | 4UQ2 | 3788 | ILGKGSMRDKAKVE | -4.9286 | -5.6476 |
HLA-A24:02 | 5HGA | 3788 | ILGKGSMRDKAKVE | -10.376 | -10.5849 |
HLA-A24:02 | 5HGA | 3788 | ILGKGSMRDKAKVE | -9.89232 | -10.1012 |
HLA-A24:02 | 5HGA | 3788 | ILGKGSMRDKAKVE | -6.61074 | -7.32974 |
HLA-A24:02 | 5HGA | 3788 | ILGKGSMRDKAKVE | -4.04677 | -4.76577 |
HLA-B44:05 | 3DX8 | 3788 | ILGKGSMRDKAKVE | -6.43311 | -7.15211 |
HLA-B44:05 | 3DX8 | 3788 | ILGKGSMRDKAKVE | -6.10174 | -6.31064 |
HLA-B44:05 | 3DX8 | 3788 | ILGKGSMRDKAKVE | -5.04732 | -5.25622 |
HLA-B44:05 | 3DX8 | 3788 | ILGKGSMRDKAKVE | -3.58503 | -4.30403 |
HLA-A02:01 | 6TDR | 3788 | ILGKGSMRDKAKVE | -5.17123 | -5.38013 |
Top |
Vaccine Design for the FusionNeoAntigens of KHDRBS3-PACRG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 12 | 21 | MRDKAKVEI | AAGGTAGAAATTGAGAAGCTGGATTAC |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 3 | 14 | KMSILGKGSMR | GGGAAAGGTTCCATGAGAGACAAGGCCAAGGTA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 1 | 16 | LTKMSILGKGSMRDK | ATCCTTGGGAAAGGTTCCATGAGAGACAAGGCCAAGGTAGAAATT |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 2 | 17 | TKMSILGKGSMRDKA | CTTGGGAAAGGTTCCATGAGAGACAAGGCCAAGGTAGAAATTGAG |
KHDRBS3-PACRG | chr8 | 136555013 | chr6 | 163483182 | 3 | 18 | KMSILGKGSMRDKAK | GGGAAAGGTTCCATGAGAGACAAGGCCAAGGTAGAAATTGAGAAG |
Top |
Information of the samples that have these potential fusion neoantigens of KHDRBS3-PACRG |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SKCM | KHDRBS3-PACRG | chr8 | 136555013 | ENST00000355849 | chr6 | 163483182 | ENST00000337019 | TCGA-ER-A2ND-06A |
Top |
Potential target of CAR-T therapy development for KHDRBS3-PACRG |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to KHDRBS3-PACRG |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to KHDRBS3-PACRG |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |