![]() |
|||||||
|
Fusion Protein:KIF13A-PTPRK |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: KIF13A-PTPRK | FusionPDB ID: 42536 | FusionGDB2.0 ID: 42536 | Hgene | Tgene | Gene symbol | KIF13A | PTPRK | Gene ID | 63971 | 5796 |
Gene name | kinesin family member 13A | protein tyrosine phosphatase receptor type K | |
Synonyms | RBKIN|bA500C11.2 | R-PTP-kappa | |
Cytomap | 6p22.3 | 6q22.33 | |
Type of gene | protein-coding | protein-coding | |
Description | kinesin-like protein KIF13Ahomolog of mouse KIF13A mannose-6-phosphate receptor transporterkinesin-like protein RBKIN | receptor-type tyrosine-protein phosphatase kappadJ480J14.2.1 (protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA, protein tyrosine phosphatase kappa , protein tyrosine phosphatase kappaprotein-tyrosine phosphatase kappaprotein-tyrosine phospha | |
Modification date | 20200313 | 20200322 | |
UniProtAcc | Q9H1H9 Main function of 5'-partner protein: FUNCTION: Plus end-directed microtubule-dependent motor protein involved in intracellular transport and regulating various processes such as mannose-6-phosphate receptor (M6PR) transport to the plasma membrane, endosomal sorting during melanosome biogenesis and cytokinesis. Mediates the transport of M6PR-containing vesicles from trans-Golgi network to the plasma membrane via direct interaction with the AP-1 complex. During melanosome maturation, required for delivering melanogenic enzymes from recycling endosomes to nascent melanosomes by creating peripheral recycling endosomal subdomains in melanocytes. Also required for the abcission step in cytokinesis: mediates translocation of ZFYVE26, and possibly TTC19, to the midbody during cytokinesis. {ECO:0000269|PubMed:19841138, ECO:0000269|PubMed:20208530}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000259711, ENST00000378814, ENST00000378816, ENST00000378826, ENST00000378843, ENST00000502704, ENST00000503342, | ENST00000524481, ENST00000525459, ENST00000368207, ENST00000368210, ENST00000368213, ENST00000368215, ENST00000368226, ENST00000368227, ENST00000532331, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 14 X 12 X 9=1512 | 17 X 12 X 9=1836 |
# samples | 17 | 21 | |
** MAII score | log2(17/1512*10)=-3.15285148808337 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(21/1836*10)=-3.12810482574769 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: KIF13A [Title/Abstract] AND PTPRK [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: KIF13A [Title/Abstract] AND PTPRK [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | KIF13A(17825999)-PTPRK(128718833), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | KIF13A-PTPRK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KIF13A-PTPRK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KIF13A-PTPRK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KIF13A-PTPRK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | PTPRK | GO:0006470 | protein dephosphorylation | 16263724 |
Tgene | PTPRK | GO:0007165 | signal transduction | 16849327 |
Tgene | PTPRK | GO:0007179 | transforming growth factor beta receptor signaling pathway | 15899872 |
Tgene | PTPRK | GO:0008285 | negative regulation of cell proliferation | 15899872|18276111 |
Tgene | PTPRK | GO:0010839 | negative regulation of keratinocyte proliferation | 16263724 |
Tgene | PTPRK | GO:0030336 | negative regulation of cell migration | 18276111 |
Tgene | PTPRK | GO:0034394 | protein localization to cell surface | 18276111 |
Tgene | PTPRK | GO:0034614 | cellular response to reactive oxygen species | 16849327 |
Tgene | PTPRK | GO:0034644 | cellular response to UV | 16849327 |
Tgene | PTPRK | GO:0045786 | negative regulation of cell cycle | 15899872 |
Tgene | PTPRK | GO:0045892 | negative regulation of transcription, DNA-templated | 18276111 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:17825999/chr6:128718833) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000378814 | KIF13A | chr6 | 17825999 | - | ENST00000368226 | PTPRK | chr6 | 128718833 | - | 7457 | 1786 | 0 | 6008 | 2002 |
ENST00000378814 | KIF13A | chr6 | 17825999 | - | ENST00000368227 | PTPRK | chr6 | 128718833 | - | 7507 | 1786 | 0 | 6059 | 2019 |
ENST00000378814 | KIF13A | chr6 | 17825999 | - | ENST00000532331 | PTPRK | chr6 | 128718833 | - | 7325 | 1786 | 0 | 6074 | 2024 |
ENST00000378814 | KIF13A | chr6 | 17825999 | - | ENST00000368213 | PTPRK | chr6 | 128718833 | - | 7277 | 1786 | 0 | 6026 | 2008 |
ENST00000378814 | KIF13A | chr6 | 17825999 | - | ENST00000368210 | PTPRK | chr6 | 128718833 | - | 6453 | 1786 | 0 | 6062 | 2020 |
ENST00000378814 | KIF13A | chr6 | 17825999 | - | ENST00000368215 | PTPRK | chr6 | 128718833 | - | 6337 | 1786 | 0 | 6005 | 2001 |
ENST00000378814 | KIF13A | chr6 | 17825999 | - | ENST00000368207 | PTPRK | chr6 | 128718833 | - | 6219 | 1786 | 0 | 6104 | 2034 |
ENST00000259711 | KIF13A | chr6 | 17825999 | - | ENST00000368226 | PTPRK | chr6 | 128718833 | - | 7563 | 1892 | 106 | 6114 | 2002 |
ENST00000259711 | KIF13A | chr6 | 17825999 | - | ENST00000368227 | PTPRK | chr6 | 128718833 | - | 7613 | 1892 | 106 | 6165 | 2019 |
ENST00000259711 | KIF13A | chr6 | 17825999 | - | ENST00000532331 | PTPRK | chr6 | 128718833 | - | 7431 | 1892 | 106 | 6180 | 2024 |
ENST00000259711 | KIF13A | chr6 | 17825999 | - | ENST00000368213 | PTPRK | chr6 | 128718833 | - | 7383 | 1892 | 106 | 6132 | 2008 |
ENST00000259711 | KIF13A | chr6 | 17825999 | - | ENST00000368210 | PTPRK | chr6 | 128718833 | - | 6559 | 1892 | 106 | 6168 | 2020 |
ENST00000259711 | KIF13A | chr6 | 17825999 | - | ENST00000368215 | PTPRK | chr6 | 128718833 | - | 6443 | 1892 | 106 | 6111 | 2001 |
ENST00000259711 | KIF13A | chr6 | 17825999 | - | ENST00000368207 | PTPRK | chr6 | 128718833 | - | 6325 | 1892 | 106 | 6210 | 2034 |
ENST00000378843 | KIF13A | chr6 | 17825999 | - | ENST00000368226 | PTPRK | chr6 | 128718833 | - | 7475 | 1804 | 18 | 6026 | 2002 |
ENST00000378843 | KIF13A | chr6 | 17825999 | - | ENST00000368227 | PTPRK | chr6 | 128718833 | - | 7525 | 1804 | 18 | 6077 | 2019 |
ENST00000378843 | KIF13A | chr6 | 17825999 | - | ENST00000532331 | PTPRK | chr6 | 128718833 | - | 7343 | 1804 | 18 | 6092 | 2024 |
ENST00000378843 | KIF13A | chr6 | 17825999 | - | ENST00000368213 | PTPRK | chr6 | 128718833 | - | 7295 | 1804 | 18 | 6044 | 2008 |
ENST00000378843 | KIF13A | chr6 | 17825999 | - | ENST00000368210 | PTPRK | chr6 | 128718833 | - | 6471 | 1804 | 18 | 6080 | 2020 |
ENST00000378843 | KIF13A | chr6 | 17825999 | - | ENST00000368215 | PTPRK | chr6 | 128718833 | - | 6355 | 1804 | 18 | 6023 | 2001 |
ENST00000378843 | KIF13A | chr6 | 17825999 | - | ENST00000368207 | PTPRK | chr6 | 128718833 | - | 6237 | 1804 | 18 | 6122 | 2034 |
ENST00000378826 | KIF13A | chr6 | 17825999 | - | ENST00000368226 | PTPRK | chr6 | 128718833 | - | 7476 | 1805 | 19 | 6027 | 2002 |
ENST00000378826 | KIF13A | chr6 | 17825999 | - | ENST00000368227 | PTPRK | chr6 | 128718833 | - | 7526 | 1805 | 19 | 6078 | 2019 |
ENST00000378826 | KIF13A | chr6 | 17825999 | - | ENST00000532331 | PTPRK | chr6 | 128718833 | - | 7344 | 1805 | 19 | 6093 | 2024 |
ENST00000378826 | KIF13A | chr6 | 17825999 | - | ENST00000368213 | PTPRK | chr6 | 128718833 | - | 7296 | 1805 | 19 | 6045 | 2008 |
ENST00000378826 | KIF13A | chr6 | 17825999 | - | ENST00000368210 | PTPRK | chr6 | 128718833 | - | 6472 | 1805 | 19 | 6081 | 2020 |
ENST00000378826 | KIF13A | chr6 | 17825999 | - | ENST00000368215 | PTPRK | chr6 | 128718833 | - | 6356 | 1805 | 19 | 6024 | 2001 |
ENST00000378826 | KIF13A | chr6 | 17825999 | - | ENST00000368207 | PTPRK | chr6 | 128718833 | - | 6238 | 1805 | 19 | 6123 | 2034 |
ENST00000378816 | KIF13A | chr6 | 17825999 | - | ENST00000368226 | PTPRK | chr6 | 128718833 | - | 7562 | 1891 | 105 | 6113 | 2002 |
ENST00000378816 | KIF13A | chr6 | 17825999 | - | ENST00000368227 | PTPRK | chr6 | 128718833 | - | 7612 | 1891 | 105 | 6164 | 2019 |
ENST00000378816 | KIF13A | chr6 | 17825999 | - | ENST00000532331 | PTPRK | chr6 | 128718833 | - | 7430 | 1891 | 105 | 6179 | 2024 |
ENST00000378816 | KIF13A | chr6 | 17825999 | - | ENST00000368213 | PTPRK | chr6 | 128718833 | - | 7382 | 1891 | 105 | 6131 | 2008 |
ENST00000378816 | KIF13A | chr6 | 17825999 | - | ENST00000368210 | PTPRK | chr6 | 128718833 | - | 6558 | 1891 | 105 | 6167 | 2020 |
ENST00000378816 | KIF13A | chr6 | 17825999 | - | ENST00000368215 | PTPRK | chr6 | 128718833 | - | 6442 | 1891 | 105 | 6110 | 2001 |
ENST00000378816 | KIF13A | chr6 | 17825999 | - | ENST00000368207 | PTPRK | chr6 | 128718833 | - | 6324 | 1891 | 105 | 6209 | 2034 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000378814 | ENST00000368226 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000266236 | 0.99973375 |
ENST00000378814 | ENST00000368227 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000589351 | 0.9994106 |
ENST00000378814 | ENST00000532331 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000579648 | 0.9994204 |
ENST00000378814 | ENST00000368213 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000462114 | 0.99953794 |
ENST00000378814 | ENST00000368210 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.001049346 | 0.9989506 |
ENST00000378814 | ENST00000368215 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000646762 | 0.99935323 |
ENST00000378814 | ENST00000368207 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000951945 | 0.99904805 |
ENST00000259711 | ENST00000368226 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000304713 | 0.9996953 |
ENST00000259711 | ENST00000368227 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000669891 | 0.99933016 |
ENST00000259711 | ENST00000532331 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.00066043 | 0.9993395 |
ENST00000259711 | ENST00000368213 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000531987 | 0.999468 |
ENST00000259711 | ENST00000368210 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.001185926 | 0.9988141 |
ENST00000259711 | ENST00000368215 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000730621 | 0.9992694 |
ENST00000259711 | ENST00000368207 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.001067989 | 0.99893194 |
ENST00000378843 | ENST00000368226 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000277303 | 0.99972266 |
ENST00000378843 | ENST00000368227 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.00061115 | 0.9993888 |
ENST00000378843 | ENST00000532331 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000602307 | 0.99939764 |
ENST00000378843 | ENST00000368213 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000480512 | 0.99951947 |
ENST00000378843 | ENST00000368210 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.001085353 | 0.9989147 |
ENST00000378843 | ENST00000368215 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000669589 | 0.9993304 |
ENST00000378843 | ENST00000368207 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000981395 | 0.99901855 |
ENST00000378826 | ENST00000368226 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000277276 | 0.99972266 |
ENST00000378826 | ENST00000368227 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000611205 | 0.9993888 |
ENST00000378826 | ENST00000532331 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000602184 | 0.99939775 |
ENST00000378826 | ENST00000368213 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000480289 | 0.9995197 |
ENST00000378826 | ENST00000368210 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.001083862 | 0.99891615 |
ENST00000378826 | ENST00000368215 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000668681 | 0.99933136 |
ENST00000378826 | ENST00000368207 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000980359 | 0.9990196 |
ENST00000378816 | ENST00000368226 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000310488 | 0.9996896 |
ENST00000378816 | ENST00000368227 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000678043 | 0.99932194 |
ENST00000378816 | ENST00000532331 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.00066864 | 0.99933136 |
ENST00000378816 | ENST00000368213 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000540063 | 0.9994599 |
ENST00000378816 | ENST00000368210 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.00120666 | 0.99879336 |
ENST00000378816 | ENST00000368215 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.000743505 | 0.99925643 |
ENST00000378816 | ENST00000368207 | KIF13A | chr6 | 17825999 | - | PTPRK | chr6 | 128718833 | - | 0.001086249 | 0.99891376 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for KIF13A-PTPRK |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
KIF13A | chr6 | 17825999 | PTPRK | chr6 | 128718833 | 1786 | 595 | AQMEVIMKTLNSNGGCTFDDGPGACD |
KIF13A | chr6 | 17825999 | PTPRK | chr6 | 128718833 | 1804 | 595 | AQMEVIMKTLNSNGGCTFDDGPGACD |
KIF13A | chr6 | 17825999 | PTPRK | chr6 | 128718833 | 1805 | 595 | AQMEVIMKTLNSNGGCTFDDGPGACD |
KIF13A | chr6 | 17825999 | PTPRK | chr6 | 128718833 | 1891 | 595 | AQMEVIMKTLNSNGGCTFDDGPGACD |
KIF13A | chr6 | 17825999 | PTPRK | chr6 | 128718833 | 1892 | 595 | AQMEVIMKTLNSNGGCTFDDGPGACD |
Top |
Potential FusionNeoAntigen Information of KIF13A-PTPRK in HLA I |
![]() |
KIF13A-PTPRK_17825999_128718833.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
KIF13A-PTPRK | chr6 | 17825999 | chr6 | 128718833 | 1892 | HLA-B57:01 | KTLNSNGGCTF | 0.9997 | 0.7754 | 7 | 18 |
KIF13A-PTPRK | chr6 | 17825999 | chr6 | 128718833 | 1892 | HLA-B57:03 | KTLNSNGGCTF | 0.9982 | 0.7614 | 7 | 18 |
KIF13A-PTPRK | chr6 | 17825999 | chr6 | 128718833 | 1892 | HLA-B15:17 | KTLNSNGGCTF | 0.9978 | 0.681 | 7 | 18 |
KIF13A-PTPRK | chr6 | 17825999 | chr6 | 128718833 | 1892 | HLA-B57:10 | KTLNSNGGCTF | 0.9997 | 0.7754 | 7 | 18 |
KIF13A-PTPRK | chr6 | 17825999 | chr6 | 128718833 | 1892 | HLA-B57:04 | KTLNSNGGCTF | 0.999 | 0.5545 | 7 | 18 |
KIF13A-PTPRK | chr6 | 17825999 | chr6 | 128718833 | 1892 | HLA-B57:02 | KTLNSNGGCTF | 0.9944 | 0.7101 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of KIF13A-PTPRK in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of KIF13A-PTPRK |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5945 | MKTLNSNGGCTFDD | KIF13A | PTPRK | chr6 | 17825999 | chr6 | 128718833 | 1892 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KIF13A-PTPRK |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5945 | MKTLNSNGGCTFDD | -6.01316 | -6.12656 |
HLA-B14:02 | 3BVN | 5945 | MKTLNSNGGCTFDD | -3.92858 | -4.96388 |
HLA-B52:01 | 3W39 | 5945 | MKTLNSNGGCTFDD | -5.92102 | -6.95632 |
HLA-B52:01 | 3W39 | 5945 | MKTLNSNGGCTFDD | -4.84472 | -4.95812 |
HLA-A24:02 | 5HGA | 5945 | MKTLNSNGGCTFDD | -8.26357 | -9.29887 |
HLA-A24:02 | 5HGA | 5945 | MKTLNSNGGCTFDD | -7.03366 | -7.14706 |
HLA-B44:05 | 3DX8 | 5945 | MKTLNSNGGCTFDD | -6.13971 | -6.25311 |
HLA-B44:05 | 3DX8 | 5945 | MKTLNSNGGCTFDD | -5.20728 | -6.24258 |
HLA-A02:01 | 6TDR | 5945 | MKTLNSNGGCTFDD | -5.28864 | -5.40204 |
Top |
Vaccine Design for the FusionNeoAntigens of KIF13A-PTPRK |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
KIF13A-PTPRK | chr6 | 17825999 | chr6 | 128718833 | 7 | 18 | KTLNSNGGCTF | AAACCCTGAATAGTAATGGTGGCTGTACTTTTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of KIF13A-PTPRK |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUAD | KIF13A-PTPRK | chr6 | 17825999 | ENST00000259711 | chr6 | 128718833 | ENST00000368207 | TCGA-44-7671-01A |
Top |
Potential target of CAR-T therapy development for KIF13A-PTPRK |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | PTPRK | chr6:17825999 | chr6:128718833 | ENST00000368213 | 0 | 31 | 753_774 | 0 | 1447.0 | Transmembrane | Helical | |
Tgene | PTPRK | chr6:17825999 | chr6:128718833 | ENST00000368215 | 0 | 30 | 753_774 | 0 | 1440.0 | Transmembrane | Helical | |
Tgene | PTPRK | chr6:17825999 | chr6:128718833 | ENST00000368226 | 0 | 30 | 753_774 | 0 | 1441.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to KIF13A-PTPRK |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to KIF13A-PTPRK |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |