Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KSR1-MSI2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KSR1-MSI2
	FusionPDB ID: 43721
	FusionGDB2.0 ID: 43721
		Hgene	Tgene
	Gene symbol	KSR1	MSI2
	Gene ID	8844	124540
	Gene name	kinase suppressor of ras 1	musashi RNA binding protein 2
	Synonyms	KSR\|RSU2	MSI2H
	Cytomap	17q11.2	17q22
	Type of gene	protein-coding	protein-coding
	Description	kinase suppressor of Ras 1	RNA-binding protein Musashi homolog 2musashi homolog 2musashi-2
	Modification date	20200327	20200313
	UniProtAcc	Q8IVT5 Main function of 5'-partner protein: FUNCTION: Part of a multiprotein signaling complex which promotes phosphorylation of Raf family members and activation of downstream MAP kinases (By similarity). Independently of its kinase activity, acts as MAP2K1/MEK1 and MAP2K2/MEK2-dependent allosteric activator of BRAF; upon binding to MAP2K1/MEK1 or MAP2K2/MEK2, dimerizes with BRAF and promotes BRAF-mediated phosphorylation of MAP2K1/MEK1 and/or MAP2K2/MEK2 (PubMed:29433126). Promotes activation of MAPK1 and/or MAPK3, both in response to EGF and to cAMP (By similarity). Its kinase activity is unsure (By similarity). Some protein kinase activity has been detected in vitro, however the physiological relevance of this activity is unknown (By similarity). {ECO:0000250\|UniProtKB:Q61097, ECO:0000269\|PubMed:29433126}.	Q96DH6 Main function of 5'-partner protein: FUNCTION: RNA binding protein that regulates the expression of target mRNAs at the translation level. May play a role in the proliferation and maintenance of stem cells in the central nervous system (By similarity). {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000319524, ENST00000509603, ENST00000268763, ENST00000398988, ENST00000578981, ENST00000581975, ENST00000582410,	ENST00000579505, ENST00000284073, ENST00000322684, ENST00000416426, ENST00000442934, ENST00000579180,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 9 X 6=540	26 X 18 X 10=4680
	# samples	10	30
	** MAII score	log2(10/540*10)=-2.43295940727611 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(30/4680*10)=-3.96347412397489 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KSR1 [Title/Abstract] AND MSI2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KSR1 [Title/Abstract] AND MSI2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KSR1(25783900)-MSI2(55478740), # samples:3
Anticipated loss of major functional domain due to fusion event.	KSR1-MSI2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KSR1-MSI2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KSR1-MSI2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KSR1-MSI2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	KSR1	GO:0000185	activation of MAPKKK activity	29433126

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:25783900/chr17:55478740)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KSR1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MSI2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000509603	KSR1	chr17	25783900	+	ENST00000416426	MSI2	chr17	55478740	+	1564	231	0	959	319
ENST00000509603	KSR1	chr17	25783900	+	ENST00000284073	MSI2	chr17	55478740	+	6074	231	0	905	301
ENST00000509603	KSR1	chr17	25783900	+	ENST00000322684	MSI2	chr17	55478740	+	1756	231	0	686	228
ENST00000509603	KSR1	chr17	25783900	+	ENST00000442934	MSI2	chr17	55478740	+	1686	231	0	905	301
ENST00000509603	KSR1	chr17	25783900	+	ENST00000579180	MSI2	chr17	55478740	+	1761	231	0	686	228
ENST00000319524	KSR1	chr17	25783900	+	ENST00000416426	MSI2	chr17	55478740	+	1564	231	0	959	319
ENST00000319524	KSR1	chr17	25783900	+	ENST00000284073	MSI2	chr17	55478740	+	6074	231	0	905	301
ENST00000319524	KSR1	chr17	25783900	+	ENST00000322684	MSI2	chr17	55478740	+	1756	231	0	686	228
ENST00000319524	KSR1	chr17	25783900	+	ENST00000442934	MSI2	chr17	55478740	+	1686	231	0	905	301
ENST00000319524	KSR1	chr17	25783900	+	ENST00000579180	MSI2	chr17	55478740	+	1761	231	0	686	228

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000509603	ENST00000416426	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.001216385	0.99878365
ENST00000509603	ENST00000284073	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.000162742	0.9998373
ENST00000509603	ENST00000322684	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.00129819	0.9987018
ENST00000509603	ENST00000442934	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.001012942	0.998987
ENST00000509603	ENST00000579180	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.001243829	0.9987562
ENST00000319524	ENST00000416426	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.001216385	0.99878365
ENST00000319524	ENST00000284073	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.000162742	0.9998373
ENST00000319524	ENST00000322684	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.00129819	0.9987018
ENST00000319524	ENST00000442934	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.001012942	0.998987
ENST00000319524	ENST00000579180	KSR1	chr17	25783900	+	MSI2	chr17	55478740	+	0.001243829	0.9987562

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KSR1-MSI2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KSR1	chr17	25783900	MSI2	chr17	55478740	231	75	AVSNDLTQQEIRTLEMVTRTKKIFVG

Top

Potential FusionNeoAntigen Information of KSR1-MSI2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KSR1-MSI2_25783900_55478740.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B14:01	TQQEIRTL	0.9983	0.663	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B14:02	TQQEIRTL	0.9983	0.663	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B18:01	QEIRTLEM	0.998	0.9214	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B13:01	TQQEIRTL	0.954	0.9098	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:37	TQQEIRTL	0.8935	0.6483	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B52:01	TQQEIRTL	0.8885	0.8174	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B39:13	TQQEIRTL	0.8733	0.8654	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B45:01	QEIRTLEMV	0.9985	0.9367	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B50:02	QEIRTLEMV	0.9978	0.7504	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:17	LTQQEIRTL	0.9714	0.8691	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B14:02	QQEIRTLEM	0.9678	0.8277	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B14:01	QQEIRTLEM	0.9678	0.8277	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B57:03	LTQQEIRTL	0.9611	0.9641	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:16	LTQQEIRTL	0.9574	0.6941	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B41:01	QEIRTLEMV	0.9074	0.9371	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B13:01	QQEIRTLEM	0.8966	0.9639	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B41:02	QEIRTLEMV	0.7786	0.515	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B50:01	QEIRTLEMV	0.5872	0.8503	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-A30:08	RTLEMVTRTK	0.9971	0.7042	11	21
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-A30:08	RTLEMVTRTKK	0.9959	0.7191	11	22
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B39:08	TQQEIRTL	0.973	0.7762	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B14:03	TQQEIRTL	0.9682	0.6628	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B51:07	TQQEIRTL	0.8542	0.7418	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C15:04	LTQQEIRTL	0.9996	0.7535	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B40:06	QEIRTLEMV	0.9994	0.7242	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C03:19	LTQQEIRTL	0.9993	0.9685	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C03:08	LTQQEIRTL	0.9993	0.8979	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C03:07	LTQQEIRTL	0.999	0.8867	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C15:06	LTQQEIRTL	0.9989	0.8024	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B44:10	QEIRTLEMV	0.9864	0.6034	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B39:09	QQEIRTLEM	0.9739	0.9273	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B39:08	QQEIRTLEM	0.9625	0.971	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B39:12	QQEIRTLEM	0.9595	0.9623	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C12:12	LTQQEIRTL	0.9303	0.9544	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C06:03	LTQQEIRTL	0.9046	0.9848	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C12:04	LTQQEIRTL	0.8995	0.979	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B14:03	QQEIRTLEM	0.874	0.8837	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C02:06	LTQQEIRTL	0.835	0.8826	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B40:04	QEIRTLEM	0.9995	0.7145	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B18:11	QEIRTLEM	0.9989	0.9322	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B18:06	QEIRTLEM	0.9981	0.9284	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B18:08	QEIRTLEM	0.9981	0.8901	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B18:05	QEIRTLEM	0.998	0.9214	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B18:04	QEIRTLEM	0.998	0.9281	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B18:03	QEIRTLEM	0.9955	0.9099	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:73	TQQEIRTL	0.9914	0.8816	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B41:03	QEIRTLEM	0.9891	0.7306	8	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:30	TQQEIRTL	0.9837	0.818	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B39:02	TQQEIRTL	0.9756	0.8722	6	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C15:09	LTQQEIRTL	0.9996	0.7535	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C03:04	LTQQEIRTL	0.9992	0.9765	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C03:03	LTQQEIRTL	0.9992	0.9765	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C15:02	LTQQEIRTL	0.999	0.7557	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C15:05	LTQQEIRTL	0.9989	0.7689	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C03:17	LTQQEIRTL	0.9972	0.9696	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C03:05	LTQQEIRTL	0.9962	0.9368	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B40:04	QEIRTLEMV	0.9956	0.783	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C16:04	LTQQEIRTL	0.9757	0.9749	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B39:02	QQEIRTLEM	0.9741	0.9848	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B41:03	QEIRTLEMV	0.9441	0.8204	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B08:12	QQEIRTLEM	0.9417	0.8292	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C03:06	LTQQEIRTL	0.9346	0.978	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B39:11	QQEIRTLEM	0.933	0.918	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C16:02	LTQQEIRTL	0.9191	0.9786	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:73	QQEIRTLEM	0.8951	0.9811	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C16:01	LTQQEIRTL	0.8667	0.9634	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B57:02	LTQQEIRTL	0.8615	0.7521	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:30	QQEIRTLEM	0.8471	0.9719	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:09	QQEIRTLEM	0.7123	0.9296	7	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-C17:01	LTQQEIRTL	0.7095	0.6953	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B50:05	QEIRTLEMV	0.5872	0.8503	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B50:04	QEIRTLEMV	0.5872	0.8503	8	17
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B07:13	LTQQEIRTL	0.4421	0.7997	5	14
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-A30:01	RTLEMVTRTK	0.997	0.7913	11	21
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:73	TQQEIRTLEM	0.9863	0.9702	6	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-B15:30	TQQEIRTLEM	0.9846	0.9522	6	16
KSR1-MSI2	chr17	25783900	chr17	55478740	231	HLA-A30:01	RTLEMVTRTKK	0.9962	0.8094	11	22

Top

Potential FusionNeoAntigen Information of KSR1-MSI2 in HLA II

KSR1-MSI2_25783900_55478740.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KSR1-MSI2	chr17	25783900	chr17	55478740	231	DRB1-1204	QQEIRTLEMVTRTKK	7	22
KSR1-MSI2	chr17	25783900	chr17	55478740	231	DRB1-1204	TQQEIRTLEMVTRTK	6	21
KSR1-MSI2	chr17	25783900	chr17	55478740	231	DRB1-1209	QQEIRTLEMVTRTKK	7	22
KSR1-MSI2	chr17	25783900	chr17	55478740	231	DRB1-1209	TQQEIRTLEMVTRTK	6	21

Top

Fusion breakpoint peptide structures of KSR1-MSI2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9579	TQQEIRTLEMVTRT	KSR1	MSI2	chr17	25783900	chr17	55478740	231

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KSR1-MSI2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9579	TQQEIRTLEMVTRT	-7.9962	-8.1096
HLA-B14:02	3BVN	9579	TQQEIRTLEMVTRT	-5.70842	-6.74372
HLA-B52:01	3W39	9579	TQQEIRTLEMVTRT	-6.83737	-6.95077
HLA-B52:01	3W39	9579	TQQEIRTLEMVTRT	-4.4836	-5.5189
HLA-A11:01	4UQ2	9579	TQQEIRTLEMVTRT	-10.0067	-10.1201
HLA-A11:01	4UQ2	9579	TQQEIRTLEMVTRT	-9.03915	-10.0745
HLA-A24:02	5HGA	9579	TQQEIRTLEMVTRT	-6.56204	-6.67544
HLA-A24:02	5HGA	9579	TQQEIRTLEMVTRT	-5.42271	-6.45801
HLA-B44:05	3DX8	9579	TQQEIRTLEMVTRT	-7.85648	-8.89178
HLA-B44:05	3DX8	9579	TQQEIRTLEMVTRT	-5.3978	-5.5112
HLA-A02:01	6TDR	9579	TQQEIRTLEMVTRT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of KSR1-MSI2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KSR1-MSI2	chr17	25783900	chr17	55478740	11	21	RTLEMVTRTK	CTGGAGATGGTCACAAGAACAAAGAAAATA
KSR1-MSI2	chr17	25783900	chr17	55478740	11	22	RTLEMVTRTKK	CTGGAGATGGTCACAAGAACAAAGAAAATATTT
KSR1-MSI2	chr17	25783900	chr17	55478740	5	14	LTQQEIRTL	CAGCAGGAGATACGGACCCTGGAGATG
KSR1-MSI2	chr17	25783900	chr17	55478740	6	14	TQQEIRTL	CAGGAGATACGGACCCTGGAGATG
KSR1-MSI2	chr17	25783900	chr17	55478740	6	16	TQQEIRTLEM	CAGGAGATACGGACCCTGGAGATGGTCACA
KSR1-MSI2	chr17	25783900	chr17	55478740	7	16	QQEIRTLEM	GAGATACGGACCCTGGAGATGGTCACA
KSR1-MSI2	chr17	25783900	chr17	55478740	8	16	QEIRTLEM	ATACGGACCCTGGAGATGGTCACA
KSR1-MSI2	chr17	25783900	chr17	55478740	8	17	QEIRTLEMV	ATACGGACCCTGGAGATGGTCACAAGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
KSR1-MSI2	chr17	25783900	chr17	55478740	6	21	TQQEIRTLEMVTRTK	CAGGAGATACGGACCCTGGAGATGGTCACAAGAACAAAGAAAATA
KSR1-MSI2	chr17	25783900	chr17	55478740	7	22	QQEIRTLEMVTRTKK	GAGATACGGACCCTGGAGATGGTCACAAGAACAAAGAAAATATTT

Top

Information of the samples that have these potential fusion neoantigens of KSR1-MSI2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	KSR1-MSI2	chr17	25783900	ENST00000319524	chr17	55478740	ENST00000284073	TCGA-E2-A14V-01A

Top

Potential target of CAR-T therapy development for KSR1-MSI2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KSR1-MSI2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KSR1-MSI2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)