|
|||||||
|
Fusion Protein:LBH-FLT4 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: LBH-FLT4 | FusionPDB ID: 44218 | FusionGDB2.0 ID: 44218 | Hgene | Tgene | Gene symbol | LBH | FLT4 | Gene ID | 221491 | 2324 |
| Gene name | small integral membrane protein 29 | fms related receptor tyrosine kinase 4 | |
| Synonyms | C6orf1|LBH | CHTD7|FLT-4|FLT41|LMPH1A|LMPHM1|PCL|VEGFR-3|VEGFR3 | |
| Cytomap | 6p21.31 | 5q35.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | small integral membrane protein 29uncharacterized protein C6orf1 | vascular endothelial growth factor receptor 3Feline McDonough Sarcoma (FMS)-like tyrosine kinase 4VEGF receptor-3fms related tyrosine kinase 4fms-like tyrosine kinase 4primary congenital lymphedematyrosine-protein kinase receptor FLT4 | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q9BQE6 Main function of 5'-partner protein: | P35916 Main function of 5'-partner protein: FUNCTION: Tyrosine-protein kinase that acts as a cell-surface receptor for VEGFC and VEGFD, and plays an essential role in adult lymphangiogenesis and in the development of the vascular network and the cardiovascular system during embryonic development. Promotes proliferation, survival and migration of endothelial cells, and regulates angiogenic sprouting. Signaling by activated FLT4 leads to enhanced production of VEGFC, and to a lesser degree VEGFA, thereby creating a positive feedback loop that enhances FLT4 signaling. Modulates KDR signaling by forming heterodimers. The secreted isoform 3 may function as a decoy receptor for VEGFC and/or VEGFD and play an important role as a negative regulator of VEGFC-mediated lymphangiogenesis and angiogenesis. Binding of vascular growth factors to isoform 1 or isoform 2 leads to the activation of several signaling cascades; isoform 2 seems to be less efficient in signal transduction, because it has a truncated C-terminus and therefore lacks several phosphorylation sites. Mediates activation of the MAPK1/ERK2, MAPK3/ERK1 signaling pathway, of MAPK8 and the JUN signaling pathway, and of the AKT1 signaling pathway. Phosphorylates SHC1. Mediates phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase. Promotes phosphorylation of MAPK8 at 'Thr-183' and 'Tyr-185', and of AKT1 at 'Ser-473'. {ECO:0000269|PubMed:11532940, ECO:0000269|PubMed:15102829, ECO:0000269|PubMed:15474514, ECO:0000269|PubMed:16076871, ECO:0000269|PubMed:16452200, ECO:0000269|PubMed:17210781, ECO:0000269|PubMed:19610651, ECO:0000269|PubMed:19779139, ECO:0000269|PubMed:20224550, ECO:0000269|PubMed:20431062, ECO:0000269|PubMed:20445537, ECO:0000269|PubMed:21273538, ECO:0000269|PubMed:7675451, ECO:0000269|PubMed:8700872, ECO:0000269|PubMed:9435229}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000467242, ENST00000395323, ENST00000401506, ENST00000404397, ENST00000406087, ENST00000407930, | ENST00000261937, ENST00000393347, ENST00000502649, ENST00000424276, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 5 X 5 X 2=50 | 5 X 4 X 3=60 |
| # samples | 5 | 5 | |
| ** MAII score | log2(5/50*10)=0 | log2(5/60*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: LBH [Title/Abstract] AND FLT4 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: LBH [Title/Abstract] AND FLT4 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | LBH(30457373)-FLT4(180058778), # samples:3 | ||
| Anticipated loss of major functional domain due to fusion event. | LBH-FLT4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LBH-FLT4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LBH-FLT4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LBH-FLT4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LBH-FLT4 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. LBH-FLT4 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. LBH-FLT4 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. LBH-FLT4 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | FLT4 | GO:0018108 | peptidyl-tyrosine phosphorylation | 7898938 |
| Tgene | FLT4 | GO:0035924 | cellular response to vascular endothelial growth factor stimulus | 9435229 |
| Tgene | FLT4 | GO:0038084 | vascular endothelial growth factor signaling pathway | 23878260 |
| Tgene | FLT4 | GO:0046777 | protein autophosphorylation | 7675451|9435229|23878260 |
| Tgene | FLT4 | GO:0048010 | vascular endothelial growth factor receptor signaling pathway | 9012504 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:30457373/chr5:180058778) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across LBH (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across FLT4 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000406087 | LBH | chr2 | 30457373 | + | ENST00000261937 | FLT4 | chr5 | 180058778 | - | 6055 | 335 | 202 | 4368 | 1388 |
| ENST00000406087 | LBH | chr2 | 30457373 | + | ENST00000393347 | FLT4 | chr5 | 180058778 | - | 4490 | 335 | 202 | 4173 | 1323 |
| ENST00000406087 | LBH | chr2 | 30457373 | + | ENST00000502649 | FLT4 | chr5 | 180058778 | - | 4362 | 335 | 202 | 4197 | 1331 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000406087 | ENST00000261937 | LBH | chr2 | 30457373 | + | FLT4 | chr5 | 180058778 | - | 0.003552398 | 0.99644756 |
| ENST00000406087 | ENST00000393347 | LBH | chr2 | 30457373 | + | FLT4 | chr5 | 180058778 | - | 0.004232271 | 0.9957677 |
| ENST00000406087 | ENST00000502649 | LBH | chr2 | 30457373 | + | FLT4 | chr5 | 180058778 | - | 0.004065583 | 0.99593437 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for LBH-FLT4 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| LBH | chr2 | 30457373 | FLT4 | chr5 | 180058778 | 335 | 45 | LSPRKDGLSYQVSLVSGYSMTPPTLN |
Top |
Potential FusionNeoAntigen Information of LBH-FLT4 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| LBH-FLT4_30457373_180058778.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B52:01 | LSYQVSLV | 0.9969 | 0.9507 | 7 | 15 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:01 | YQVSLVSGY | 0.9996 | 0.6613 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:17 | VSLVSGYSM | 0.9862 | 0.8901 | 11 | 20 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:25 | YQVSLVSGY | 0.9842 | 0.8118 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:16 | VSLVSGYSM | 0.979 | 0.5752 | 11 | 20 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B14:01 | DGLSYQVSL | 0.9768 | 0.6131 | 5 | 14 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B14:02 | DGLSYQVSL | 0.9768 | 0.6131 | 5 | 14 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:02 | YQVSLVSGY | 0.9683 | 0.8349 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:03 | YQVSLVSGY | 0.722 | 0.5803 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:25 | SYQVSLVSGY | 0.8994 | 0.7187 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:01 | SYQVSLVSGY | 0.8987 | 0.663 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:17 | LSYQVSLVSGY | 0.9942 | 0.7754 | 7 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C03:19 | VSLVSGYSM | 0.9938 | 0.9857 | 11 | 20 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C03:08 | VSLVSGYSM | 0.9932 | 0.9104 | 11 | 20 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:21 | YQVSLVSGY | 0.9674 | 0.7916 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B14:03 | DGLSYQVSL | 0.9489 | 0.6235 | 5 | 14 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B51:07 | DGLSYQVSL | 0.9459 | 0.7737 | 5 | 14 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:05 | YQVSLVSGY | 0.9363 | 0.7438 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:04 | YQVSLVSGY | 0.9214 | 0.6935 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:31 | YQVSLVSGY | 0.9191 | 0.755 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C12:16 | YQVSLVSGY | 0.6992 | 0.9357 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C03:14 | YQVSLVSGY | 0.6446 | 0.9648 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:05 | SYQVSLVSGY | 0.7991 | 0.6375 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:04 | SYQVSLVSGY | 0.7881 | 0.7015 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:125 | YQVSLVSGY | 0.9996 | 0.6613 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:34 | YQVSLVSGY | 0.9996 | 0.6613 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:33 | YQVSLVSGY | 0.9996 | 0.6613 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:27 | YQVSLVSGY | 0.9996 | 0.7094 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:135 | YQVSLVSGY | 0.9995 | 0.671 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:50 | YQVSLVSGY | 0.9994 | 0.8217 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:11 | YQVSLVSGY | 0.9989 | 0.5839 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:08 | YQVSLVSGY | 0.9988 | 0.5836 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B35:43 | YQVSLVSGY | 0.9984 | 0.5855 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:24 | YQVSLVSGY | 0.9981 | 0.7472 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:12 | YQVSLVSGY | 0.9971 | 0.7072 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:53 | YQVSLVSGY | 0.997 | 0.6186 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:35 | YQVSLVSGY | 0.9953 | 0.6605 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C03:03 | VSLVSGYSM | 0.9936 | 0.9876 | 11 | 20 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C03:04 | VSLVSGYSM | 0.9936 | 0.9876 | 11 | 20 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C03:02 | VSLVSGYSM | 0.9934 | 0.9659 | 11 | 20 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C03:05 | VSLVSGYSM | 0.9876 | 0.9279 | 11 | 20 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:39 | YQVSLVSGY | 0.9842 | 0.6739 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:54 | YQVSLVSGY | 0.9739 | 0.5826 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:20 | YQVSLVSGY | 0.9365 | 0.8233 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B18:11 | YQVSLVSGY | 0.929 | 0.81 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B35:28 | YQVSLVSGY | 0.9215 | 0.8295 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B35:20 | YQVSLVSGY | 0.9109 | 0.8385 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:13 | YQVSLVSGY | 0.806 | 0.5845 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C07:17 | YQVSLVSGY | 0.7899 | 0.9381 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B18:04 | YQVSLVSGY | 0.7685 | 0.753 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B18:08 | YQVSLVSGY | 0.7236 | 0.6899 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B18:07 | YQVSLVSGY | 0.6825 | 0.6428 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:73 | YQVSLVSGY | 0.6763 | 0.6872 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B18:06 | YQVSLVSGY | 0.6722 | 0.7165 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C12:02 | YQVSLVSGY | 0.5709 | 0.9423 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B48:02 | YQVSLVSGY | 0.5561 | 0.805 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-A25:01 | YQVSLVSGY | 0.5053 | 0.7467 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C03:02 | YQVSLVSGY | 0.409 | 0.9363 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C02:02 | YQVSLVSGY | 0.3827 | 0.9531 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C02:10 | YQVSLVSGY | 0.3827 | 0.9531 | 9 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:12 | SYQVSLVSGY | 0.9271 | 0.6316 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:50 | SYQVSLVSGY | 0.9047 | 0.7215 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:34 | SYQVSLVSGY | 0.8987 | 0.663 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:125 | SYQVSLVSGY | 0.8987 | 0.663 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:33 | SYQVSLVSGY | 0.8987 | 0.663 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:27 | SYQVSLVSGY | 0.8959 | 0.6765 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:135 | SYQVSLVSGY | 0.8805 | 0.687 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:35 | SYQVSLVSGY | 0.8532 | 0.6687 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:53 | SYQVSLVSGY | 0.8509 | 0.6214 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:20 | SYQVSLVSGY | 0.807 | 0.7191 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B35:28 | SYQVSLVSGY | 0.7502 | 0.7433 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-B15:54 | SYQVSLVSGY | 0.6661 | 0.5862 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C14:02 | SYQVSLVSGY | 0.2855 | 0.9131 | 8 | 18 |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 | HLA-C14:03 | SYQVSLVSGY | 0.2855 | 0.9131 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of LBH-FLT4 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of LBH-FLT4 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 2964 | GLSYQVSLVSGYSM | LBH | FLT4 | chr2 | 30457373 | chr5 | 180058778 | 335 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LBH-FLT4 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 2964 | GLSYQVSLVSGYSM | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 2964 | GLSYQVSLVSGYSM | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 2964 | GLSYQVSLVSGYSM | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 2964 | GLSYQVSLVSGYSM | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 2964 | GLSYQVSLVSGYSM | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 2964 | GLSYQVSLVSGYSM | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 2964 | GLSYQVSLVSGYSM | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 2964 | GLSYQVSLVSGYSM | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 2964 | GLSYQVSLVSGYSM | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 2964 | GLSYQVSLVSGYSM | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 2964 | GLSYQVSLVSGYSM | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of LBH-FLT4 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 11 | 20 | VSLVSGYSM | AGGTGAGCCTGGTGAGTGGCTACTCCA |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 5 | 14 | DGLSYQVSL | AGGATGGCCTTTCCTACCAGGTGAGCC |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 7 | 15 | LSYQVSLV | GCCTTTCCTACCAGGTGAGCCTGG |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 7 | 18 | LSYQVSLVSGY | GCCTTTCCTACCAGGTGAGCCTGGTGAGTGGCT |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 8 | 18 | SYQVSLVSGY | TTTCCTACCAGGTGAGCCTGGTGAGTGGCT |
| LBH-FLT4 | chr2 | 30457373 | chr5 | 180058778 | 9 | 18 | YQVSLVSGY | CCTACCAGGTGAGCCTGGTGAGTGGCT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of LBH-FLT4 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| SKCM | LBH-FLT4 | chr2 | 30457373 | ENST00000406087 | chr5 | 180058778 | ENST00000261937 | TCGA-D3-A3CF-06A |
Top |
Potential target of CAR-T therapy development for LBH-FLT4 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Tgene | FLT4 | chr2:30457373 | chr5:180058778 | ENST00000261937 | 0 | 30 | 776_796 | 0 | 1364.0 | Transmembrane | Helical | |
| Tgene | FLT4 | chr2:30457373 | chr5:180058778 | ENST00000393347 | 0 | 30 | 776_796 | 0 | 1299.0 | Transmembrane | Helical |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to LBH-FLT4 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to LBH-FLT4 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies