Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ABI2-DIAPH2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ABI2-DIAPH2
	FusionPDB ID: 458
	FusionGDB2.0 ID: 458
		Hgene	Tgene
	Gene symbol	ABI2	DIAPH2
	Gene ID	10152	1730
	Gene name	abl interactor 2	diaphanous related formin 2
	Synonyms	ABI-2\|ABI2B\|AIP-1\|AIP1\|AblBP3\|SSH3BP2\|argBP1\|argBPIA\|argBPIB	DIA\|DIA2\|DRF2\|POF\|POF2\|POF2A
	Cytomap	2q33.2	Xq21.33
	Type of gene	protein-coding	protein-coding
	Description	abl interactor 2abelson interactor 2abl binding protein 3abl-interacting protein 1 (SH3-containing protein)abl-interactor protein 2barg protein tyrosine kinase-binding proteinarg-binding protein 1	protein diaphanous homolog 2diaphanous homolog 2diaphorase-2
	Modification date	20200327	20200313
	UniProtAcc	Q9NYB9 Main function of 5'-partner protein: FUNCTION: Regulator of actin cytoskeleton dynamics underlying cell motility and adhesion. Functions as a component of the WAVE complex, which activates actin nucleating machinery Arp2/3 to drive lamellipodia formation (PubMed:21107423). Acts as regulator and substrate of nonreceptor tyrosine kinases ABL1 and ABL2 involved in processes linked to cell growth and differentiation. Positively regulates ABL1-mediated phosphorylation of ENAH, which is required for proper polymerization of nucleated actin filaments at the leading edge (PubMed:7590236, PubMed:8649853, PubMed:10498863). Contributes to the regulation of actin assembly at the tips of neuron projections. In particular, controls dendritic spine morphogenesis and may promote dendritic spine specification toward large mushroom-type spines known as repositories of memory in the brain (By similarity). In hippocampal neurons, may mediate actin-dependent BDNF-NTRK2 early endocytic trafficking that triggers dendrite outgrowth (By similarity). Participates in ocular lens morphogenesis, likely by regulating lamellipodia-driven adherens junction formation at the epithelial cell-secondary lens fiber interface (By similarity). Also required for nascent adherens junction assembly in epithelial cells (PubMed:15572692). {ECO:0000250\|UniProtKB:P62484, ECO:0000269\|PubMed:10498863, ECO:0000269\|PubMed:15572692, ECO:0000269\|PubMed:21107423, ECO:0000269\|PubMed:7590236, ECO:0000269\|PubMed:8649853}.	Q14236 Main function of 5'-partner protein: FUNCTION: May function as an early signal that helps mediate the activation of T-cells. {ECO:0000269\|PubMed:8133036}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000261016, ENST00000261017, ENST00000295851, ENST00000422511, ENST00000424558, ENST00000430418, ENST00000261018, ENST00000430574,	ENST00000324765, ENST00000355827, ENST00000373049, ENST00000373054, ENST00000373061,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 7 X 8=784	11 X 12 X 5=660
	# samples	17	12
	** MAII score	log2(17/784*10)=-2.20531890797751 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(12/660*10)=-2.4594316186373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ABI2 [Title/Abstract] AND DIAPH2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ABI2 [Title/Abstract] AND DIAPH2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ABI2(204231767)-DIAPH2(96354693), # samples:1
Anticipated loss of major functional domain due to fusion event.	ABI2-DIAPH2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ABI2-DIAPH2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ABI2-DIAPH2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ABI2-DIAPH2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ABI2-DIAPH2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ABI2-DIAPH2 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. ABI2-DIAPH2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ABI2	GO:0016601	Rac protein signal transduction	21107423
Hgene	ABI2	GO:0018108	peptidyl-tyrosine phosphorylation	17101133
Hgene	ABI2	GO:2000601	positive regulation of Arp2/3 complex-mediated actin nucleation	21107423

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:204231767/chrX:96354693)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ABI2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across DIAPH2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000295851	ABI2	chr2	204231767	+	ENST00000355827	DIAPH2	chrX	96354693	+	1720	581	263	1624	453
ENST00000295851	ABI2	chr2	204231767	+	ENST00000373054	DIAPH2	chrX	96354693	+	1640	581	263	1639	459
ENST00000295851	ABI2	chr2	204231767	+	ENST00000373061	DIAPH2	chrX	96354693	+	2921	581	263	1639	458
ENST00000295851	ABI2	chr2	204231767	+	ENST00000373049	DIAPH2	chrX	96354693	+	1717	581	263	1624	453
ENST00000295851	ABI2	chr2	204231767	+	ENST00000324765	DIAPH2	chrX	96354693	+	7320	581	263	1639	458
ENST00000261017	ABI2	chr2	204231767	+	ENST00000355827	DIAPH2	chrX	96354693	+	1659	520	202	1563	453
ENST00000261017	ABI2	chr2	204231767	+	ENST00000373054	DIAPH2	chrX	96354693	+	1579	520	202	1578	459
ENST00000261017	ABI2	chr2	204231767	+	ENST00000373061	DIAPH2	chrX	96354693	+	2860	520	202	1578	458
ENST00000261017	ABI2	chr2	204231767	+	ENST00000373049	DIAPH2	chrX	96354693	+	1656	520	202	1563	453
ENST00000261017	ABI2	chr2	204231767	+	ENST00000324765	DIAPH2	chrX	96354693	+	7259	520	202	1578	458
ENST00000430418	ABI2	chr2	204231767	+	ENST00000355827	DIAPH2	chrX	96354693	+	1547	408	90	1451	453
ENST00000430418	ABI2	chr2	204231767	+	ENST00000373054	DIAPH2	chrX	96354693	+	1467	408	90	1466	458
ENST00000430418	ABI2	chr2	204231767	+	ENST00000373061	DIAPH2	chrX	96354693	+	2748	408	90	1466	458
ENST00000430418	ABI2	chr2	204231767	+	ENST00000373049	DIAPH2	chrX	96354693	+	1544	408	90	1451	453
ENST00000430418	ABI2	chr2	204231767	+	ENST00000324765	DIAPH2	chrX	96354693	+	7147	408	90	1466	458
ENST00000424558	ABI2	chr2	204231767	+	ENST00000355827	DIAPH2	chrX	96354693	+	1544	405	87	1448	453
ENST00000424558	ABI2	chr2	204231767	+	ENST00000373054	DIAPH2	chrX	96354693	+	1464	405	87	1463	458
ENST00000424558	ABI2	chr2	204231767	+	ENST00000373061	DIAPH2	chrX	96354693	+	2745	405	87	1463	458
ENST00000424558	ABI2	chr2	204231767	+	ENST00000373049	DIAPH2	chrX	96354693	+	1541	405	87	1448	453
ENST00000424558	ABI2	chr2	204231767	+	ENST00000324765	DIAPH2	chrX	96354693	+	7144	405	87	1463	458
ENST00000422511	ABI2	chr2	204231767	+	ENST00000355827	DIAPH2	chrX	96354693	+	1455	316	31	1359	442
ENST00000422511	ABI2	chr2	204231767	+	ENST00000373054	DIAPH2	chrX	96354693	+	1375	316	31	1374	448
ENST00000422511	ABI2	chr2	204231767	+	ENST00000373061	DIAPH2	chrX	96354693	+	2656	316	31	1374	447
ENST00000422511	ABI2	chr2	204231767	+	ENST00000373049	DIAPH2	chrX	96354693	+	1452	316	31	1359	442
ENST00000422511	ABI2	chr2	204231767	+	ENST00000324765	DIAPH2	chrX	96354693	+	7055	316	31	1374	447

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000295851	ENST00000355827	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.00188177	0.9981183
ENST00000295851	ENST00000373054	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.002394606	0.9976053
ENST00000295851	ENST00000373061	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000582769	0.9994173
ENST00000295851	ENST00000373049	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.002048381	0.9979517
ENST00000295851	ENST00000324765	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000203739	0.99979633
ENST00000261017	ENST00000355827	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.0016385	0.9983615
ENST00000261017	ENST00000373054	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.002065023	0.99793494
ENST00000261017	ENST00000373061	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000602083	0.9993979
ENST00000261017	ENST00000373049	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.001826578	0.9981735
ENST00000261017	ENST00000324765	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000202894	0.99979717
ENST00000430418	ENST00000355827	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.001692281	0.9983077
ENST00000430418	ENST00000373054	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.002159832	0.99784017
ENST00000430418	ENST00000373061	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.00064636	0.9993536
ENST00000430418	ENST00000373049	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.001901086	0.9980989
ENST00000430418	ENST00000324765	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000211584	0.99978846
ENST00000424558	ENST00000355827	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.0017337	0.9982663
ENST00000424558	ENST00000373054	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.002184634	0.9978154
ENST00000424558	ENST00000373061	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000649706	0.99935025
ENST00000424558	ENST00000373049	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.001931383	0.99806863
ENST00000424558	ENST00000324765	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000211318	0.9997887
ENST00000422511	ENST00000355827	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.00342057	0.99657947
ENST00000422511	ENST00000373054	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.004165845	0.9958341
ENST00000422511	ENST00000373061	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000763605	0.99923646
ENST00000422511	ENST00000373049	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.003770341	0.9962296
ENST00000422511	ENST00000324765	ABI2	chr2	204231767	+	DIAPH2	chrX	96354693	+	0.000213872	0.9997862

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ABI2-DIAPH2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ABI2	chr2	204231767	DIAPH2	chrX	96354693	316	95	LRRMESSINHISQNLVKHLPEQKILN
ABI2	chr2	204231767	DIAPH2	chrX	96354693	405	106	LRRMESSINHISQNLVKHLPEQKILN
ABI2	chr2	204231767	DIAPH2	chrX	96354693	408	106	LRRMESSINHISQNLVKHLPEQKILN
ABI2	chr2	204231767	DIAPH2	chrX	96354693	520	106	LRRMESSINHISQNLVKHLPEQKILN
ABI2	chr2	204231767	DIAPH2	chrX	96354693	581	106	LRRMESSINHISQNLVKHLPEQKILN

Top

Potential FusionNeoAntigen Information of ABI2-DIAPH2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ABI2-DIAPH2_204231767_96354693.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:06	NHISQNLV	0.9994	0.7706	8	16
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B15:10	NHISQNLV	0.9984	0.531	8	16
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B15:37	NHISQNLV	0.9922	0.6748	8	16
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B13:01	SQNLVKHL	0.9461	0.8614	11	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:13	SQNLVKHL	0.8696	0.8111	11	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B52:01	SQNLVKHL	0.8352	0.7121	11	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-A02:22	SINHISQNL	0.9788	0.5179	6	15
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:01	NHISQNLVKHL	0.9996	0.7076	8	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B38:02	NHISQNLVKHL	0.9992	0.89	8	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B38:01	NHISQNLVKHL	0.999	0.8596	8	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:05	NHISQNLV	0.9986	0.9004	8	16
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B15:04	SQNLVKHL	0.9947	0.7921	11	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C03:08	ISQNLVKHL	0.9996	0.7706	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C03:07	ISQNLVKHL	0.9996	0.9585	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C15:04	ISQNLVKHL	0.9995	0.8013	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C15:06	ISQNLVKHL	0.9993	0.8344	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C06:03	ISQNLVKHL	0.9829	0.983	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C12:04	ISQNLVKHL	0.9822	0.9871	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C02:06	SINHISQNL	0.9369	0.919	6	15
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C02:06	ISQNLVKHL	0.6104	0.9295	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:12	NHISQNLVKHL	0.9995	0.7147	8	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:05	NHISQNLVKHL	0.999	0.6834	8	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B15:73	SQNLVKHL	0.9919	0.6642	11	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:02	SQNLVKHL	0.9784	0.8144	11	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B15:30	SQNLVKHL	0.9773	0.5496	11	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C15:09	ISQNLVKHL	0.9995	0.8013	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C03:05	ISQNLVKHL	0.9994	0.8697	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C03:17	ISQNLVKHL	0.9994	0.948	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C15:05	ISQNLVKHL	0.9991	0.8433	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C15:02	ISQNLVKHL	0.999	0.7727	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B15:73	SINHISQNL	0.9389	0.903	6	15
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-A32:01	SINHISQNL	0.9115	0.9581	6	15
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B15:30	SINHISQNL	0.8939	0.7925	6	15
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C16:02	ISQNLVKHL	0.836	0.9806	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C16:01	ISQNLVKHL	0.8281	0.9674	10	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B07:13	SINHISQNL	0.7997	0.8026	6	15
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-C17:01	SINHISQNL	0.6623	0.8703	6	15
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:31	NHISQNLVKHL	0.9996	0.7062	8	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B38:05	NHISQNLVKHL	0.999	0.8596	8	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	HLA-B39:11	NHISQNLVKHL	0.9902	0.6355	8	19

Top

Potential FusionNeoAntigen Information of ABI2-DIAPH2 in HLA II

ABI2-DIAPH2_204231767_96354693.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-0819	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-0825	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-0834	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-0906	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1201	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1201	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1201	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1203	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1203	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1203	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1205	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1205	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1205	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1206	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1206	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1206	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1207	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1207	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1207	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1208	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1208	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1208	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1210	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1210	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1210	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1211	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1211	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1211	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1212	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1212	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1212	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1213	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1213	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1213	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1214	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1214	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1214	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1215	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1215	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1215	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1217	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1217	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1217	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1218	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1218	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1218	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1219	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1219	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1219	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1220	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1220	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1220	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1221	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1221	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1221	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1221	RMESSINHISQNLVK	2	17
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1223	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1223	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1223	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1377	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1377	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1404	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1404	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1404	RMESSINHISQNLVK	2	17
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1428	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1428	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1428	RMESSINHISQNLVK	2	17
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1431	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1431	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1439	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1439	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1439	RMESSINHISQNLVK	2	17
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1448	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1448	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1450	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1461	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1461	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1461	RMESSINHISQNLVK	2	17
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1470	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1471	MESSINHISQNLVKH	3	18
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1471	ESSINHISQNLVKHL	4	19
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1503	SQNLVKHLPEQKILN	11	26
ABI2-DIAPH2	chr2	204231767	chrX	96354693	520	DRB1-1523	SQNLVKHLPEQKILN	11	26

Top

Fusion breakpoint peptide structures of ABI2-DIAPH2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8664	SINHISQNLVKHLP	ABI2	DIAPH2	chr2	204231767	chrX	96354693	520

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ABI2-DIAPH2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8664	SINHISQNLVKHLP	-7.15543	-7.26883
HLA-B14:02	3BVN	8664	SINHISQNLVKHLP	-4.77435	-5.80965
HLA-B52:01	3W39	8664	SINHISQNLVKHLP	-6.80875	-6.92215
HLA-B52:01	3W39	8664	SINHISQNLVKHLP	-4.20386	-5.23916
HLA-A11:01	4UQ2	8664	SINHISQNLVKHLP	-7.5194	-8.5547
HLA-A11:01	4UQ2	8664	SINHISQNLVKHLP	-6.9601	-7.0735
HLA-A24:02	5HGA	8664	SINHISQNLVKHLP	-7.52403	-7.63743
HLA-A24:02	5HGA	8664	SINHISQNLVKHLP	-5.82433	-6.85963
HLA-B27:05	6PYJ	8664	SINHISQNLVKHLP	-3.28285	-4.31815
HLA-B44:05	3DX8	8664	SINHISQNLVKHLP	-5.91172	-6.94702
HLA-B44:05	3DX8	8664	SINHISQNLVKHLP	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ABI2-DIAPH2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ABI2-DIAPH2	chr2	204231767	chrX	96354693	10	19	ISQNLVKHL	ATTTCACAAAACCTTGTGAAACATCTT
ABI2-DIAPH2	chr2	204231767	chrX	96354693	11	19	SQNLVKHL	TCACAAAACCTTGTGAAACATCTT
ABI2-DIAPH2	chr2	204231767	chrX	96354693	6	15	SINHISQNL	TCAATCAATCATATTTCACAAAACCTT
ABI2-DIAPH2	chr2	204231767	chrX	96354693	8	16	NHISQNLV	AATCATATTTCACAAAACCTTGTG
ABI2-DIAPH2	chr2	204231767	chrX	96354693	8	19	NHISQNLVKHL	AATCATATTTCACAAAACCTTGTGAAACATCTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ABI2-DIAPH2	chr2	204231767	chrX	96354693	11	26	SQNLVKHLPEQKILN	TCACAAAACCTTGTGAAACATCTTCCTGAGCAGAAGATACTCAAC
ABI2-DIAPH2	chr2	204231767	chrX	96354693	2	17	RMESSINHISQNLVK	AGGATGGAATCTTCAATCAATCATATTTCACAAAACCTTGTGAAA
ABI2-DIAPH2	chr2	204231767	chrX	96354693	3	18	MESSINHISQNLVKH	ATGGAATCTTCAATCAATCATATTTCACAAAACCTTGTGAAACAT
ABI2-DIAPH2	chr2	204231767	chrX	96354693	4	19	ESSINHISQNLVKHL	GAATCTTCAATCAATCATATTTCACAAAACCTTGTGAAACATCTT

Top

Information of the samples that have these potential fusion neoantigens of ABI2-DIAPH2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ABI2-DIAPH2	chr2	204231767	ENST00000261017	chrX	96354693	ENST00000324765	TCGA-BR-8365-01A

Top

Potential target of CAR-T therapy development for ABI2-DIAPH2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ABI2-DIAPH2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ABI2-DIAPH2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)