Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:LRP8-PAX8

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: LRP8-PAX8
	FusionPDB ID: 49837
	FusionGDB2.0 ID: 49837
		Hgene	Tgene
	Gene symbol	LRP8	PAX8
	Gene ID	7804	7849
	Gene name	LDL receptor related protein 8	paired box 8
	Synonyms	APOER2\|HSZ75190\|LRP-8\|MCI1	-
	Cytomap	1p32.3	2q14.1
	Type of gene	protein-coding	protein-coding
	Description	low-density lipoprotein receptor-related protein 8ApoE receptor 2low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	paired box protein Pax-8paired domain gene 8
	Modification date	20200313	20200313
	UniProtAcc	Q14114 Main function of 5'-partner protein: FUNCTION: Cell surface receptor for Reelin (RELN) and apolipoprotein E (apoE)-containing ligands. LRP8 participates in transmitting the extracellular Reelin signal to intracellular signaling processes, by binding to DAB1 on its cytoplasmic tail. Reelin acts via both the VLDL receptor (VLDLR) and LRP8 to regulate DAB1 tyrosine phosphorylation and microtubule function in neurons. LRP8 has higher affinity for Reelin than VLDLR. LRP8 is thus a key component of the Reelin pathway which governs neuronal layering of the forebrain during embryonic brain development. Binds the endoplasmic reticulum resident receptor-associated protein (RAP). Binds dimers of beta 2-glycoprotein I and may be involved in the suppression of platelet aggregation in the vasculature. Highly expressed in the initial segment of the epididymis, where it affects the functional expression of clusterin and phospholipid hydroperoxide glutathione peroxidase (PHGPx), two proteins required for sperm maturation. May also function as an endocytic receptor. Not required for endocytic uptake of SEPP1 in the kidney which is mediated by LRP2 (By similarity). Together with its ligand, apolipoprotein E (apoE), may indirectly play a role in the suppression of the innate immune response by controlling the survival of myeloid-derived suppressor cells (By similarity). {ECO:0000250\|UniProtKB:Q924X6, ECO:0000269\|PubMed:12807892, ECO:0000269\|PubMed:12899622, ECO:0000269\|PubMed:12950167}.	Q06710 Main function of 5'-partner protein: FUNCTION: Transcription factor for the thyroid-specific expression of the genes exclusively expressed in the thyroid cell type, maintaining the functional differentiation of such cells.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000460214, ENST00000465675, ENST00000306052, ENST00000347547, ENST00000354412, ENST00000371454,	ENST00000263334, ENST00000263335, ENST00000348715, ENST00000397647, ENST00000429538,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 12 X 6=576	5 X 6 X 4=120
	# samples	11	8
	** MAII score	log2(11/576*10)=-2.38856528791765 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/120*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: LRP8 [Title/Abstract] AND PAX8 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: LRP8 [Title/Abstract] AND PAX8 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	LRP8(53723991)-PAX8(114004496), # samples:3
Anticipated loss of major functional domain due to fusion event.	LRP8-PAX8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LRP8-PAX8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LRP8-PAX8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LRP8-PAX8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LRP8-PAX8 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. LRP8-PAX8 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	LRP8	GO:0006897	endocytosis	8626535
Tgene	PAX8	GO:0006351	transcription, DNA-templated	9590296
Tgene	PAX8	GO:0045893	positive regulation of transcription, DNA-templated	9388203\|15356023\|15961562
Tgene	PAX8	GO:0045944	positive regulation of transcription by RNA polymerase II	9388203
Tgene	PAX8	GO:0071371	cellular response to gonadotropin stimulus	15961562

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:53723991/chr2:114004496)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across LRP8 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PAX8 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000306052	LRP8	chr1	53723991	-	ENST00000348715	PAX8	chr2	114004496	-	6096	2311	39	3482	1147
ENST00000306052	LRP8	chr1	53723991	-	ENST00000397647	PAX8	chr2	114004496	-	5763	2311	39	3149	1036
ENST00000306052	LRP8	chr1	53723991	-	ENST00000263335	PAX8	chr2	114004496	-	5865	2311	39	3251	1070
ENST00000306052	LRP8	chr1	53723991	-	ENST00000429538	PAX8	chr2	114004496	-	6175	2311	39	3638	1199
ENST00000306052	LRP8	chr1	53723991	-	ENST00000263334	PAX8	chr2	114004496	-	3483	2311	39	3482	1147
ENST00000371454	LRP8	chr1	53723991	-	ENST00000348715	PAX8	chr2	114004496	-	6136	2351	79	3522	1147
ENST00000371454	LRP8	chr1	53723991	-	ENST00000397647	PAX8	chr2	114004496	-	5803	2351	79	3189	1036
ENST00000371454	LRP8	chr1	53723991	-	ENST00000263335	PAX8	chr2	114004496	-	5905	2351	79	3291	1070
ENST00000371454	LRP8	chr1	53723991	-	ENST00000429538	PAX8	chr2	114004496	-	6215	2351	79	3678	1199
ENST00000371454	LRP8	chr1	53723991	-	ENST00000263334	PAX8	chr2	114004496	-	3523	2351	79	3522	1148
ENST00000354412	LRP8	chr1	53723991	-	ENST00000348715	PAX8	chr2	114004496	-	5607	1822	0	2993	997
ENST00000354412	LRP8	chr1	53723991	-	ENST00000397647	PAX8	chr2	114004496	-	5274	1822	0	2660	886
ENST00000354412	LRP8	chr1	53723991	-	ENST00000263335	PAX8	chr2	114004496	-	5376	1822	0	2762	920
ENST00000354412	LRP8	chr1	53723991	-	ENST00000429538	PAX8	chr2	114004496	-	5686	1822	0	3149	1049
ENST00000354412	LRP8	chr1	53723991	-	ENST00000263334	PAX8	chr2	114004496	-	2994	1822	0	2993	997
ENST00000347547	LRP8	chr1	53723991	-	ENST00000348715	PAX8	chr2	114004496	-	5484	1699	0	2870	956
ENST00000347547	LRP8	chr1	53723991	-	ENST00000397647	PAX8	chr2	114004496	-	5151	1699	0	2537	845
ENST00000347547	LRP8	chr1	53723991	-	ENST00000263335	PAX8	chr2	114004496	-	5253	1699	0	2639	879
ENST00000347547	LRP8	chr1	53723991	-	ENST00000429538	PAX8	chr2	114004496	-	5563	1699	0	3026	1008
ENST00000347547	LRP8	chr1	53723991	-	ENST00000263334	PAX8	chr2	114004496	-	2871	1699	0	2870	956
ENST00000306052	LRP8	chr1	53723990	-	ENST00000348715	PAX8	chr2	114004496	-	6096	2311	39	3482	1147
ENST00000306052	LRP8	chr1	53723990	-	ENST00000397647	PAX8	chr2	114004496	-	5763	2311	39	3149	1036
ENST00000306052	LRP8	chr1	53723990	-	ENST00000263335	PAX8	chr2	114004496	-	5865	2311	39	3251	1070
ENST00000306052	LRP8	chr1	53723990	-	ENST00000429538	PAX8	chr2	114004496	-	6175	2311	39	3638	1199
ENST00000306052	LRP8	chr1	53723990	-	ENST00000263334	PAX8	chr2	114004496	-	3483	2311	39	3482	1147
ENST00000371454	LRP8	chr1	53723990	-	ENST00000348715	PAX8	chr2	114004496	-	6136	2351	79	3522	1147
ENST00000371454	LRP8	chr1	53723990	-	ENST00000397647	PAX8	chr2	114004496	-	5803	2351	79	3189	1036
ENST00000371454	LRP8	chr1	53723990	-	ENST00000263335	PAX8	chr2	114004496	-	5905	2351	79	3291	1070
ENST00000371454	LRP8	chr1	53723990	-	ENST00000429538	PAX8	chr2	114004496	-	6215	2351	79	3678	1199
ENST00000371454	LRP8	chr1	53723990	-	ENST00000263334	PAX8	chr2	114004496	-	3523	2351	79	3522	1148
ENST00000354412	LRP8	chr1	53723990	-	ENST00000348715	PAX8	chr2	114004496	-	5607	1822	0	2993	997
ENST00000354412	LRP8	chr1	53723990	-	ENST00000397647	PAX8	chr2	114004496	-	5274	1822	0	2660	886
ENST00000354412	LRP8	chr1	53723990	-	ENST00000263335	PAX8	chr2	114004496	-	5376	1822	0	2762	920
ENST00000354412	LRP8	chr1	53723990	-	ENST00000429538	PAX8	chr2	114004496	-	5686	1822	0	3149	1049
ENST00000354412	LRP8	chr1	53723990	-	ENST00000263334	PAX8	chr2	114004496	-	2994	1822	0	2993	997
ENST00000347547	LRP8	chr1	53723990	-	ENST00000348715	PAX8	chr2	114004496	-	5484	1699	0	2870	956
ENST00000347547	LRP8	chr1	53723990	-	ENST00000397647	PAX8	chr2	114004496	-	5151	1699	0	2537	845
ENST00000347547	LRP8	chr1	53723990	-	ENST00000263335	PAX8	chr2	114004496	-	5253	1699	0	2639	879
ENST00000347547	LRP8	chr1	53723990	-	ENST00000429538	PAX8	chr2	114004496	-	5563	1699	0	3026	1008
ENST00000347547	LRP8	chr1	53723990	-	ENST00000263334	PAX8	chr2	114004496	-	2871	1699	0	2870	956
ENST00000306052	LRP8	chr1	53722911	-	ENST00000348715	PAX8	chr2	114004496	-	6321	2536	39	3707	1222
ENST00000306052	LRP8	chr1	53722911	-	ENST00000397647	PAX8	chr2	114004496	-	5988	2536	39	3374	1111
ENST00000306052	LRP8	chr1	53722911	-	ENST00000263335	PAX8	chr2	114004496	-	6090	2536	39	3476	1145
ENST00000306052	LRP8	chr1	53722911	-	ENST00000429538	PAX8	chr2	114004496	-	6400	2536	39	3863	1274
ENST00000306052	LRP8	chr1	53722911	-	ENST00000263334	PAX8	chr2	114004496	-	3708	2536	39	3707	1222
ENST00000371454	LRP8	chr1	53722911	-	ENST00000348715	PAX8	chr2	114004496	-	6361	2576	79	3747	1222
ENST00000371454	LRP8	chr1	53722911	-	ENST00000397647	PAX8	chr2	114004496	-	6028	2576	79	3414	1111
ENST00000371454	LRP8	chr1	53722911	-	ENST00000263335	PAX8	chr2	114004496	-	6130	2576	79	3516	1145
ENST00000371454	LRP8	chr1	53722911	-	ENST00000429538	PAX8	chr2	114004496	-	6440	2576	79	3903	1274
ENST00000371454	LRP8	chr1	53722911	-	ENST00000263334	PAX8	chr2	114004496	-	3748	2576	79	3747	1223
ENST00000347547	LRP8	chr1	53722911	-	ENST00000348715	PAX8	chr2	114004496	-	5709	1924	0	3095	1031
ENST00000347547	LRP8	chr1	53722911	-	ENST00000397647	PAX8	chr2	114004496	-	5376	1924	0	2762	920
ENST00000347547	LRP8	chr1	53722911	-	ENST00000263335	PAX8	chr2	114004496	-	5478	1924	0	2864	954
ENST00000347547	LRP8	chr1	53722911	-	ENST00000429538	PAX8	chr2	114004496	-	5788	1924	0	3251	1083
ENST00000347547	LRP8	chr1	53722911	-	ENST00000263334	PAX8	chr2	114004496	-	3096	1924	0	3095	1031
ENST00000306052	LRP8	chr1	53722912	-	ENST00000348715	PAX8	chr2	114004496	-	6321	2536	39	3707	1222
ENST00000306052	LRP8	chr1	53722912	-	ENST00000397647	PAX8	chr2	114004496	-	5988	2536	39	3374	1111
ENST00000306052	LRP8	chr1	53722912	-	ENST00000263335	PAX8	chr2	114004496	-	6090	2536	39	3476	1145
ENST00000306052	LRP8	chr1	53722912	-	ENST00000429538	PAX8	chr2	114004496	-	6400	2536	39	3863	1274
ENST00000306052	LRP8	chr1	53722912	-	ENST00000263334	PAX8	chr2	114004496	-	3708	2536	39	3707	1222
ENST00000371454	LRP8	chr1	53722912	-	ENST00000348715	PAX8	chr2	114004496	-	6361	2576	79	3747	1222
ENST00000371454	LRP8	chr1	53722912	-	ENST00000397647	PAX8	chr2	114004496	-	6028	2576	79	3414	1111
ENST00000371454	LRP8	chr1	53722912	-	ENST00000263335	PAX8	chr2	114004496	-	6130	2576	79	3516	1145
ENST00000371454	LRP8	chr1	53722912	-	ENST00000429538	PAX8	chr2	114004496	-	6440	2576	79	3903	1274
ENST00000371454	LRP8	chr1	53722912	-	ENST00000263334	PAX8	chr2	114004496	-	3748	2576	79	3747	1223
ENST00000347547	LRP8	chr1	53722912	-	ENST00000348715	PAX8	chr2	114004496	-	5709	1924	0	3095	1031
ENST00000347547	LRP8	chr1	53722912	-	ENST00000397647	PAX8	chr2	114004496	-	5376	1924	0	2762	920
ENST00000347547	LRP8	chr1	53722912	-	ENST00000263335	PAX8	chr2	114004496	-	5478	1924	0	2864	954
ENST00000347547	LRP8	chr1	53722912	-	ENST00000429538	PAX8	chr2	114004496	-	5788	1924	0	3251	1083
ENST00000347547	LRP8	chr1	53722912	-	ENST00000263334	PAX8	chr2	114004496	-	3096	1924	0	3095	1031

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000306052	ENST00000348715	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.003229105	0.9967709
ENST00000306052	ENST00000397647	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.001999967	0.99799997
ENST00000306052	ENST00000263335	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.002673402	0.9973266
ENST00000306052	ENST00000429538	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.003071177	0.9969289
ENST00000306052	ENST00000263334	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.0077054	0.99229455
ENST00000371454	ENST00000348715	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.003405948	0.996594
ENST00000371454	ENST00000397647	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.002109507	0.99789053
ENST00000371454	ENST00000263335	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.00284675	0.9971533
ENST00000371454	ENST00000429538	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.00325425	0.9967457
ENST00000371454	ENST00000263334	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.007735615	0.9922644
ENST00000354412	ENST00000348715	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.002249292	0.9977507
ENST00000354412	ENST00000397647	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.003400826	0.99659914
ENST00000354412	ENST00000263335	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.003202335	0.99679774
ENST00000354412	ENST00000429538	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.00217854	0.99782145
ENST00000354412	ENST00000263334	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.006273261	0.99372673
ENST00000347547	ENST00000348715	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.003756755	0.99624324
ENST00000347547	ENST00000397647	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.005796082	0.99420387
ENST00000347547	ENST00000263335	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.005408316	0.99459165
ENST00000347547	ENST00000429538	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.001173355	0.9988267
ENST00000347547	ENST00000263334	LRP8	chr1	53723991	-	PAX8	chr2	114004496	-	0.010308966	0.989691
ENST00000306052	ENST00000348715	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.003229105	0.9967709
ENST00000306052	ENST00000397647	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.001999967	0.99799997
ENST00000306052	ENST00000263335	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.002673402	0.9973266
ENST00000306052	ENST00000429538	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.003071177	0.9969289
ENST00000306052	ENST00000263334	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.0077054	0.99229455
ENST00000371454	ENST00000348715	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.003405948	0.996594
ENST00000371454	ENST00000397647	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.002109507	0.99789053
ENST00000371454	ENST00000263335	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.00284675	0.9971533
ENST00000371454	ENST00000429538	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.00325425	0.9967457
ENST00000371454	ENST00000263334	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.007735615	0.9922644
ENST00000354412	ENST00000348715	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.002249292	0.9977507
ENST00000354412	ENST00000397647	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.003400826	0.99659914
ENST00000354412	ENST00000263335	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.003202335	0.99679774
ENST00000354412	ENST00000429538	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.00217854	0.99782145
ENST00000354412	ENST00000263334	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.006273261	0.99372673
ENST00000347547	ENST00000348715	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.003756755	0.99624324
ENST00000347547	ENST00000397647	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.005796082	0.99420387
ENST00000347547	ENST00000263335	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.005408316	0.99459165
ENST00000347547	ENST00000429538	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.001173355	0.9988267
ENST00000347547	ENST00000263334	LRP8	chr1	53723990	-	PAX8	chr2	114004496	-	0.010308966	0.989691
ENST00000306052	ENST00000348715	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.002918925	0.9970811
ENST00000306052	ENST00000397647	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.003204875	0.9967951
ENST00000306052	ENST00000263335	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.00217518	0.9978248
ENST00000306052	ENST00000429538	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.00223475	0.9977653
ENST00000306052	ENST00000263334	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.006625942	0.99337405
ENST00000371454	ENST00000348715	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.003087911	0.996912
ENST00000371454	ENST00000397647	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.003371481	0.99662846
ENST00000371454	ENST00000263335	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.002320728	0.9976793
ENST00000371454	ENST00000429538	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.002367706	0.99763227
ENST00000371454	ENST00000263334	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.006658461	0.9933415
ENST00000347547	ENST00000348715	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.002465442	0.9975345
ENST00000347547	ENST00000397647	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.00382296	0.9961771
ENST00000347547	ENST00000263335	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.003521067	0.996479
ENST00000347547	ENST00000429538	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.001809917	0.9981901
ENST00000347547	ENST00000263334	LRP8	chr1	53722911	-	PAX8	chr2	114004496	-	0.006311636	0.9936884
ENST00000306052	ENST00000348715	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.002918925	0.9970811
ENST00000306052	ENST00000397647	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.003204875	0.9967951
ENST00000306052	ENST00000263335	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.00217518	0.9978248
ENST00000306052	ENST00000429538	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.00223475	0.9977653
ENST00000306052	ENST00000263334	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.006625942	0.99337405
ENST00000371454	ENST00000348715	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.003087911	0.996912
ENST00000371454	ENST00000397647	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.003371481	0.99662846
ENST00000371454	ENST00000263335	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.002320728	0.9976793
ENST00000371454	ENST00000429538	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.002367706	0.99763227
ENST00000371454	ENST00000263334	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.006658461	0.9933415
ENST00000347547	ENST00000348715	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.002465442	0.9975345
ENST00000347547	ENST00000397647	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.00382296	0.9961771
ENST00000347547	ENST00000263335	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.003521067	0.996479
ENST00000347547	ENST00000429538	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.001809917	0.9981901
ENST00000347547	ENST00000263334	LRP8	chr1	53722912	-	PAX8	chr2	114004496	-	0.006311636	0.9936884

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for LRP8-PAX8

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
LRP8	chr1	53722911	PAX8	chr2	114004496	1924	14	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53722911	PAX8	chr2	114004496	2536	35	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53722911	PAX8	chr2	114004496	2576	35	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53722912	PAX8	chr2	114004496	1924	14	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53722912	PAX8	chr2	114004496	2536	35	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53722912	PAX8	chr2	114004496	2576	35	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53723990	PAX8	chr2	114004496	1699	14	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53723990	PAX8	chr2	114004496	1822	14	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53723990	PAX8	chr2	114004496	2311	35	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53723990	PAX8	chr2	114004496	2351	35	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53723991	PAX8	chr2	114004496	1699	14	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53723991	PAX8	chr2	114004496	1822	14	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53723991	PAX8	chr2	114004496	2311	35	GLPEPGPLRLLALLLLLLLLLLLQLQ
LRP8	chr1	53723991	PAX8	chr2	114004496	2351	35	GLPEPGPLRLLALLLLLLLLLLLQLQ

Top

Potential FusionNeoAntigen Information of LRP8-PAX8 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

LRP8-PAX8_53722911_114004496.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:05	LRLLALLLL	0.9997	0.9419	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:02	LRLLALLLL	0.9997	0.7822	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:04	LRLLALLLL	0.9996	0.845	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:07	LRLLALLLL	0.9994	0.9153	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B07:05	GPLRLLALL	0.9982	0.6295	5	14
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:24	RLLALLLLL	0.9705	0.5848	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:67	RLLALLLLL	0.9705	0.5848	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:30	RLLALLLLL	0.9705	0.5848	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:11	RLLALLLLL	0.9697	0.6272	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:60	RLLALLLLL	0.9677	0.6293	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:21	RLLALLLLL	0.9666	0.7133	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:04	RLLALLLLL	0.949	0.8917	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:17	RLLALLLLL	0.9454	0.9004	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A32:13	RLLALLLLL	0.9307	0.9797	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:29	RLLALLLLL	0.8725	0.5923	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:35	RLLALLLLL	0.8684	0.6339	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:20	RLLALLLLL	0.8611	0.5912	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:04	ALLLLLLLL	0.7823	0.887	11	20
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:17	ALLLLLLLL	0.753	0.8882	11	20
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B81:01	GPLRLLALL	0.3215	0.6712	5	14
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B13:02	RLLALLLLL	0.2503	0.9771	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B13:01	RLLALLLLL	0.2369	0.9961	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:07	GPLRLLALLLL	0.9666	0.7046	5	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:14	LRLLALLLL	0.9997	0.8925	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:03	LRLLALLLL	0.983	0.9468	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:01	RLLALLLLL	0.9705	0.5848	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:07	RLLALLLLL	0.9694	0.6516	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B42:01	GPLRLLALL	0.8977	0.9071	5	14
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B07:04	GPLRLLALLL	0.9074	0.5834	5	15
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:08	LRLLALLLL	0.9996	0.8605	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:10	LRLLALLLL	0.9996	0.9379	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:06	LRLLALLLL	0.9995	0.8599	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B27:09	LRLLALLLL	0.9985	0.9322	7	16
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:14	RLLALLLLL	0.9668	0.7129	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A02:06	RLLALLLLL	0.9666	0.7133	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-A32:01	RLLALLLLL	0.9663	0.991	8	17
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B55:04	GPLRLLALL	0.7818	0.6383	5	14
LRP8-PAX8	chr1	53722911	chr2	114004496	2536	HLA-B67:01	GPLRLLALL	0.6295	0.9273	5	14

Top

Potential FusionNeoAntigen Information of LRP8-PAX8 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of LRP8-PAX8

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6788	PLRLLALLLLLLLL	LRP8	PAX8	chr1	53722911	chr2	114004496	2536

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LRP8-PAX8

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6788	PLRLLALLLLLLLL	-7.9962	-8.1096
HLA-B14:02	3BVN	6788	PLRLLALLLLLLLL	-5.70842	-6.74372
HLA-B52:01	3W39	6788	PLRLLALLLLLLLL	-6.83737	-6.95077
HLA-B52:01	3W39	6788	PLRLLALLLLLLLL	-4.4836	-5.5189
HLA-A11:01	4UQ2	6788	PLRLLALLLLLLLL	-10.0067	-10.1201
HLA-A11:01	4UQ2	6788	PLRLLALLLLLLLL	-9.03915	-10.0745
HLA-A24:02	5HGA	6788	PLRLLALLLLLLLL	-6.56204	-6.67544
HLA-A24:02	5HGA	6788	PLRLLALLLLLLLL	-5.42271	-6.45801
HLA-B44:05	3DX8	6788	PLRLLALLLLLLLL	-7.85648	-8.89178
HLA-B44:05	3DX8	6788	PLRLLALLLLLLLL	-5.3978	-5.5112
HLA-A02:01	6TDR	6788	PLRLLALLLLLLLL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of LRP8-PAX8

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
LRP8-PAX8	chr1	53722911	chr2	114004496	11	20	ALLLLLLLL	AGCACTGCCATGGAGGGCTGAACCAGC
LRP8-PAX8	chr1	53722911	chr2	114004496	5	14	GPLRLLALL	CAACCAGCAACCACTCCCAGCACTGCC
LRP8-PAX8	chr1	53722911	chr2	114004496	5	15	GPLRLLALLL	CAACCAGCAACCACTCCCAGCACTGCCATG
LRP8-PAX8	chr1	53722911	chr2	114004496	5	16	GPLRLLALLLL	CAACCAGCAACCACTCCCAGCACTGCCATGGAG
LRP8-PAX8	chr1	53722911	chr2	114004496	7	16	LRLLALLLL	GCAACCACTCCCAGCACTGCCATGGAG
LRP8-PAX8	chr1	53722911	chr2	114004496	8	17	RLLALLLLL	ACCACTCCCAGCACTGCCATGGAGGGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of LRP8-PAX8

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
THCA	LRP8-PAX8	chr1	53722911	ENST00000306052	chr2	114004496	ENST00000263334	TCGA-BJ-A291

Top

Potential target of CAR-T therapy development for LRP8-PAX8

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to LRP8-PAX8

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to LRP8-PAX8

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	PAX8	C0151516	Thyroid Hypoplasia	4	GENOMICS_ENGLAND;ORPHANET
Tgene	PAX8	C0238463	Papillary thyroid carcinoma	4	ORPHANET
Tgene	PAX8	C1869118	HYPOTHYROIDISM, CONGENITAL, DUE TO THYROID DYSGENESIS	3	CTD_human;GENOMICS_ENGLAND;UNIPROT
Tgene	PAX8	C0009402	Colorectal Carcinoma	1	CTD_human
Tgene	PAX8	C0009404	Colorectal Neoplasms	1	CTD_human
Tgene	PAX8	C0010308	Congenital Hypothyroidism	1	GENOMICS_ENGLAND
Tgene	PAX8	C0266283	Ectopic thyroid tissue (disorder)	1	ORPHANET
Tgene	PAX8	C1563716	Thyroid Dysgenesis	1	GENOMICS_ENGLAND
Tgene	PAX8	C2931367	Thyroid cancer, follicular	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)