![]() |
|||||||
|
Fusion Protein:MGA-PLA2G4D |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MGA-PLA2G4D | FusionPDB ID: 53303 | FusionGDB2.0 ID: 53303 | Hgene | Tgene | Gene symbol | MGA | PLA2G4D | Gene ID | 23269 | 283748 |
Gene name | MAX dimerization protein MGA | phospholipase A2 group IVD | |
Synonyms | MAD5|MXD5 | cPLA2delta | |
Cytomap | 15q15.1 | 15q15.1 | |
Type of gene | protein-coding | protein-coding | |
Description | MAX gene-associated proteinMAX dimerization protein 5MGA, MAX dimerization protein | cytosolic phospholipase A2 deltacPLA2-deltaphospholipase A2 delta, cytosolicphospholipase A2, group IVD (cytosolic) | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q3V5L5 Main function of 5'-partner protein: FUNCTION: Glycosyltransferase that acts on alpha-linked mannose of N-glycans and O-mannosyl glycans. Catalyzes the transfer of N-acetylglucosamine (GlcNAc) to the beta 1-6 linkage of the mannose residue of GlcNAc-beta1,2-Man-alpha on both the alpha1,3- and alpha1,6-linked mannose arms in the core structure of N-glycan. Also acts on the GlcNAc-beta1,2-Man-alpha1-Ser/Thr moiety, forming a 2,6-branched structure in brain O-mannosyl glycan. Plays an active role in modulating integrin and laminin-dependent adhesion and migration of neuronal cells via its activity in the O-mannosyl glycan pathway. {ECO:0000269|PubMed:12941944, ECO:0000269|PubMed:14617637, ECO:0000269|PubMed:14623122, ECO:0000269|PubMed:16606368, ECO:0000269|PubMed:16857188, ECO:0000269|PubMed:19846580}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000219905, ENST00000389936, ENST00000545763, ENST00000566586, ENST00000570161, ENST00000568630, | ENST00000290472, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 17 X 14 X 11=2618 | 1 X 1 X 1=1 |
# samples | 18 | 1 | |
** MAII score | log2(18/2618*10)=-3.86239628561557 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(1/1*10)=3.32192809488736 | |
Fusion gene context | PubMed: MGA [Title/Abstract] AND PLA2G4D [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MGA [Title/Abstract] AND PLA2G4D [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MGA(42042813)-PLA2G4D(42373331), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | MGA-PLA2G4D seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MGA-PLA2G4D seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MGA-PLA2G4D seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MGA-PLA2G4D seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | PLA2G4D | GO:0046475 | glycerophospholipid catabolic process | 14709560 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:42042813/chr15:42373331) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000545763 | MGA | chr15 | 42042813 | + | ENST00000290472 | PLA2G4D | chr15 | 42373331 | - | 9094 | 6562 | 181 | 8061 | 2626 |
ENST00000389936 | MGA | chr15 | 42042813 | + | ENST00000290472 | PLA2G4D | chr15 | 42373331 | - | 9604 | 7072 | 181 | 8571 | 2796 |
ENST00000219905 | MGA | chr15 | 42042813 | + | ENST00000290472 | PLA2G4D | chr15 | 42373331 | - | 9721 | 7189 | 181 | 8688 | 2835 |
ENST00000566586 | MGA | chr15 | 42042813 | + | ENST00000290472 | PLA2G4D | chr15 | 42373331 | - | 8980 | 6448 | 67 | 7947 | 2626 |
ENST00000570161 | MGA | chr15 | 42042813 | + | ENST00000290472 | PLA2G4D | chr15 | 42373331 | - | 9540 | 7008 | 0 | 8507 | 2835 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000545763 | ENST00000290472 | MGA | chr15 | 42042813 | + | PLA2G4D | chr15 | 42373331 | - | 0.000992648 | 0.9990074 |
ENST00000389936 | ENST00000290472 | MGA | chr15 | 42042813 | + | PLA2G4D | chr15 | 42373331 | - | 0.000867833 | 0.9991322 |
ENST00000219905 | ENST00000290472 | MGA | chr15 | 42042813 | + | PLA2G4D | chr15 | 42373331 | - | 0.000875842 | 0.9991241 |
ENST00000566586 | ENST00000290472 | MGA | chr15 | 42042813 | + | PLA2G4D | chr15 | 42373331 | - | 0.00086856 | 0.9991315 |
ENST00000570161 | ENST00000290472 | MGA | chr15 | 42042813 | + | PLA2G4D | chr15 | 42373331 | - | 0.000734295 | 0.99926573 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MGA-PLA2G4D |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MGA | chr15 | 42042813 | PLA2G4D | chr15 | 42373331 | 6448 | 2127 | SDYQSEEVDDVEKVPVVGIMATGGGA |
MGA | chr15 | 42042813 | PLA2G4D | chr15 | 42373331 | 6562 | 2127 | SDYQSEEVDDVEKVPVVGIMATGGGA |
MGA | chr15 | 42042813 | PLA2G4D | chr15 | 42373331 | 7008 | 2336 | SDYQSEEVDDVEKVPVVGIMATGGGA |
MGA | chr15 | 42042813 | PLA2G4D | chr15 | 42373331 | 7072 | 2297 | SDYQSEEVDDVEKVPVVGIMATGGGA |
MGA | chr15 | 42042813 | PLA2G4D | chr15 | 42373331 | 7189 | 2336 | SDYQSEEVDDVEKVPVVGIMATGGGA |
Top |
Potential FusionNeoAntigen Information of MGA-PLA2G4D in HLA I |
![]() |
MGA-PLA2G4D_42042813_42373331.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B45:01 | EEVDDVEKV | 0.9982 | 0.7475 | 5 | 14 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B50:02 | EEVDDVEKV | 0.9785 | 0.5787 | 5 | 14 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B44:03 | EEVDDVEKV | 0.8717 | 0.9587 | 5 | 14 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B50:01 | VEKVPVVGI | 0.2972 | 0.5474 | 10 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B52:01 | VEKVPVVGI | 0.2709 | 0.7206 | 10 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B45:01 | EEVDDVEKVP | 0.9853 | 0.8367 | 5 | 15 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B50:02 | EEVDDVEKVP | 0.9472 | 0.5574 | 5 | 15 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B45:01 | SEEVDDVEKVP | 0.9994 | 0.8396 | 4 | 15 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B51:07 | DDVEKVPVV | 0.9851 | 0.9849 | 8 | 17 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B51:07 | VEKVPVVGI | 0.2486 | 0.6047 | 10 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B40:04 | EEVDDVEKV | 0.9784 | 0.8243 | 5 | 14 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B44:26 | EEVDDVEKV | 0.8717 | 0.9587 | 5 | 14 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B44:07 | EEVDDVEKV | 0.8717 | 0.9587 | 5 | 14 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B44:13 | EEVDDVEKV | 0.8717 | 0.9587 | 5 | 14 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B18:03 | DDVEKVPVV | 0.6728 | 0.7698 | 8 | 17 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B50:04 | VEKVPVVGI | 0.2972 | 0.5474 | 10 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-B50:05 | VEKVPVVGI | 0.2972 | 0.5474 | 10 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-A69:01 | EVDDVEKVPV | 0.9646 | 0.6216 | 6 | 16 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | HLA-A69:01 | EVDDVEKVPVV | 0.9907 | 0.7123 | 6 | 17 |
Top |
Potential FusionNeoAntigen Information of MGA-PLA2G4D in HLA II |
![]() |
MGA-PLA2G4D_42042813_42373331.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1401 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1401 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1404 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1404 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1426 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1426 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1428 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1428 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1432 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1435 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1435 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1439 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1439 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1454 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1454 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1458 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1458 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1460 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1460 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1461 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1461 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1462 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1462 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1470 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1470 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1471 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1471 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1475 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1475 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1482 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1482 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1486 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1486 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1487 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1487 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1488 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1488 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1490 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1490 | SEEVDDVEKVPVVGI | 4 | 19 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1497 | QSEEVDDVEKVPVVG | 3 | 18 |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 | DRB1-1497 | SEEVDDVEKVPVVGI | 4 | 19 |
Top |
Fusion breakpoint peptide structures of MGA-PLA2G4D |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2200 | EVDDVEKVPVVGIM | MGA | PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 7189 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MGA-PLA2G4D |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2200 | EVDDVEKVPVVGIM | -8.85616 | -8.96956 |
HLA-B14:02 | 3BVN | 2200 | EVDDVEKVPVVGIM | -5.66423 | -6.69953 |
HLA-B52:01 | 3W39 | 2200 | EVDDVEKVPVVGIM | -6.49489 | -6.60829 |
HLA-B52:01 | 3W39 | 2200 | EVDDVEKVPVVGIM | -3.99785 | -5.03315 |
HLA-A11:01 | 4UQ2 | 2200 | EVDDVEKVPVVGIM | -4.90759 | -5.94289 |
HLA-A24:02 | 5HGA | 2200 | EVDDVEKVPVVGIM | -7.27887 | -7.39227 |
HLA-A24:02 | 5HGA | 2200 | EVDDVEKVPVVGIM | -7.11524 | -8.15054 |
HLA-B27:05 | 6PYJ | 2200 | EVDDVEKVPVVGIM | -6.11615 | -6.22955 |
HLA-B27:05 | 6PYJ | 2200 | EVDDVEKVPVVGIM | -4.78818 | -5.82348 |
HLA-B44:05 | 3DX8 | 2200 | EVDDVEKVPVVGIM | -7.22602 | -7.33942 |
HLA-B44:05 | 3DX8 | 2200 | EVDDVEKVPVVGIM | -4.86671 | -5.90201 |
Top |
Vaccine Design for the FusionNeoAntigens of MGA-PLA2G4D |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 10 | 19 | VEKVPVVGI | GTAGAAAAGGTACCCGTTGTGGGCATC |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 4 | 15 | SEEVDDVEKVP | AGTGAGGAGGTTGATGATGTAGAAAAGGTACCC |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 5 | 14 | EEVDDVEKV | GAGGAGGTTGATGATGTAGAAAAGGTA |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 5 | 15 | EEVDDVEKVP | GAGGAGGTTGATGATGTAGAAAAGGTACCC |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 6 | 16 | EVDDVEKVPV | GAGGTTGATGATGTAGAAAAGGTACCCGTT |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 6 | 17 | EVDDVEKVPVV | GAGGTTGATGATGTAGAAAAGGTACCCGTTGTG |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 8 | 17 | DDVEKVPVV | GATGATGTAGAAAAGGTACCCGTTGTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 3 | 18 | QSEEVDDVEKVPVVG | CAGAGTGAGGAGGTTGATGATGTAGAAAAGGTACCCGTTGTGGGC |
MGA-PLA2G4D | chr15 | 42042813 | chr15 | 42373331 | 4 | 19 | SEEVDDVEKVPVVGI | AGTGAGGAGGTTGATGATGTAGAAAAGGTACCCGTTGTGGGCATC |
Top |
Information of the samples that have these potential fusion neoantigens of MGA-PLA2G4D |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
MESO | MGA-PLA2G4D | chr15 | 42042813 | ENST00000219905 | chr15 | 42373331 | ENST00000290472 | TCGA-TS-A7OZ-01A |
Top |
Potential target of CAR-T therapy development for MGA-PLA2G4D |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MGA-PLA2G4D |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MGA-PLA2G4D |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |