Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MTM1-VBP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MTM1-VBP1
	FusionPDB ID: 55719
	FusionGDB2.0 ID: 55719
		Hgene	Tgene
	Gene symbol	MTM1	VBP1
	Gene ID	4534	7411
	Gene name	myotubularin 1	VHL binding protein 1
	Synonyms	CNM\|MTMX\|XLMTM	HIBBJ46\|PFD3\|PFDN3\|VBP-1
	Cytomap	Xq28	Xq28
	Type of gene	protein-coding	protein-coding
	Description	myotubularinphosphatidylinositol-3,5-bisphosphate 3-phosphatasephosphatidylinositol-3-phosphate phosphatase	prefoldin subunit 3von Hippel-Lindau binding protein 1
	Modification date	20200320	20200313
	UniProtAcc	Q13496 Main function of 5'-partner protein: FUNCTION: Lipid phosphatase which dephosphorylates phosphatidylinositol 3-monophosphate (PI3P) and phosphatidylinositol 3,5-bisphosphate (PI(3,5)P2) (PubMed:11001925, PubMed:10900271, PubMed:12646134, PubMed:14722070). Has also been shown to dephosphorylate phosphotyrosine- and phosphoserine-containing peptides (PubMed:9537414). Negatively regulates EGFR degradation through regulation of EGFR trafficking from the late endosome to the lysosome (PubMed:14722070). Plays a role in vacuolar formation and morphology. Regulates desmin intermediate filament assembly and architecture (PubMed:21135508). Plays a role in mitochondrial morphology and positioning (PubMed:21135508). Required for skeletal muscle maintenance but not for myogenesis (PubMed:21135508). In skeletal muscles, stabilizes MTMR12 protein levels (PubMed:23818870). {ECO:0000269\|PubMed:10900271, ECO:0000269\|PubMed:11001925, ECO:0000269\|PubMed:12646134, ECO:0000269\|PubMed:14722070, ECO:0000269\|PubMed:21135508, ECO:0000269\|PubMed:23818870, ECO:0000269\|PubMed:9537414}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000306167, ENST00000370396, ENST00000413012, ENST00000542741, ENST00000543350,	ENST00000286428, ENST00000535916, ENST00000459836,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 4 X 3=48	7 X 8 X 4=224
	# samples	5	8
	** MAII score	log2(5/48*10)=0.0588936890535686 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(8/224*10)=-1.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MTM1 [Title/Abstract] AND VBP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MTM1 [Title/Abstract] AND VBP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MTM1(149787612)-VBP1(154448460), # samples:3
Anticipated loss of major functional domain due to fusion event.	MTM1-VBP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MTM1-VBP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MTM1-VBP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MTM1-VBP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	MTM1	GO:0006470	protein dephosphorylation	9537414
Hgene	MTM1	GO:0008333	endosome to lysosome transport	14722070
Hgene	MTM1	GO:0044088	regulation of vacuole organization	14722070
Hgene	MTM1	GO:0046856	phosphatidylinositol dephosphorylation	10900271\|12646134
Hgene	MTM1	GO:0070584	mitochondrion morphogenesis	21135508

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:149787612/chrX:154448460)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MTM1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across VBP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000370396	MTM1	chrX	149787612	+	ENST00000535916	VBP1	chrX	154448460	+	1201	498	54	998	314
ENST00000370396	MTM1	chrX	149787612	+	ENST00000286428	VBP1	chrX	154448460	+	1974	498	54	998	314
ENST00000542741	MTM1	chrX	149787612	+	ENST00000535916	VBP1	chrX	154448460	+	1104	401	185	901	238
ENST00000542741	MTM1	chrX	149787612	+	ENST00000286428	VBP1	chrX	154448460	+	1877	401	185	901	238
ENST00000543350	MTM1	chrX	149787612	+	ENST00000535916	VBP1	chrX	154448460	+	993	290	185	790	201
ENST00000543350	MTM1	chrX	149787612	+	ENST00000286428	VBP1	chrX	154448460	+	1766	290	185	790	201
ENST00000413012	MTM1	chrX	149787612	+	ENST00000535916	VBP1	chrX	154448460	+	1066	363	30	863	277
ENST00000413012	MTM1	chrX	149787612	+	ENST00000286428	VBP1	chrX	154448460	+	1839	363	30	863	277
ENST00000370396	MTM1	chrX	149787612	+	ENST00000535916	VBP1	chrX	154448459	+	1201	498	54	998	314
ENST00000370396	MTM1	chrX	149787612	+	ENST00000286428	VBP1	chrX	154448459	+	1974	498	54	998	314
ENST00000542741	MTM1	chrX	149787612	+	ENST00000535916	VBP1	chrX	154448459	+	1104	401	185	901	238
ENST00000542741	MTM1	chrX	149787612	+	ENST00000286428	VBP1	chrX	154448459	+	1877	401	185	901	238
ENST00000543350	MTM1	chrX	149787612	+	ENST00000535916	VBP1	chrX	154448459	+	993	290	185	790	201
ENST00000543350	MTM1	chrX	149787612	+	ENST00000286428	VBP1	chrX	154448459	+	1766	290	185	790	201
ENST00000413012	MTM1	chrX	149787612	+	ENST00000535916	VBP1	chrX	154448459	+	1066	363	30	863	277
ENST00000413012	MTM1	chrX	149787612	+	ENST00000286428	VBP1	chrX	154448459	+	1839	363	30	863	277

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000370396	ENST00000535916	MTM1	chrX	149787612	+	VBP1	chrX	154448460	+	0.000336403	0.9996636
ENST00000370396	ENST00000286428	MTM1	chrX	149787612	+	VBP1	chrX	154448460	+	0.000233142	0.9997669
ENST00000542741	ENST00000535916	MTM1	chrX	149787612	+	VBP1	chrX	154448460	+	0.001912596	0.99808735
ENST00000542741	ENST00000286428	MTM1	chrX	149787612	+	VBP1	chrX	154448460	+	0.001366983	0.99863297
ENST00000543350	ENST00000535916	MTM1	chrX	149787612	+	VBP1	chrX	154448460	+	0.001402955	0.9985971
ENST00000543350	ENST00000286428	MTM1	chrX	149787612	+	VBP1	chrX	154448460	+	0.000939558	0.99906045
ENST00000413012	ENST00000535916	MTM1	chrX	149787612	+	VBP1	chrX	154448460	+	0.000626642	0.9993734
ENST00000413012	ENST00000286428	MTM1	chrX	149787612	+	VBP1	chrX	154448460	+	0.00043711	0.9995629
ENST00000370396	ENST00000535916	MTM1	chrX	149787612	+	VBP1	chrX	154448459	+	0.000336403	0.9996636
ENST00000370396	ENST00000286428	MTM1	chrX	149787612	+	VBP1	chrX	154448459	+	0.000233142	0.9997669
ENST00000542741	ENST00000535916	MTM1	chrX	149787612	+	VBP1	chrX	154448459	+	0.001912596	0.99808735
ENST00000542741	ENST00000286428	MTM1	chrX	149787612	+	VBP1	chrX	154448459	+	0.001366983	0.99863297
ENST00000543350	ENST00000535916	MTM1	chrX	149787612	+	VBP1	chrX	154448459	+	0.001402955	0.9985971
ENST00000543350	ENST00000286428	MTM1	chrX	149787612	+	VBP1	chrX	154448459	+	0.000939558	0.99906045
ENST00000413012	ENST00000535916	MTM1	chrX	149787612	+	VBP1	chrX	154448459	+	0.000626642	0.9993734
ENST00000413012	ENST00000286428	MTM1	chrX	149787612	+	VBP1	chrX	154448459	+	0.00043711	0.9995629

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MTM1-VBP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MTM1	chrX	149787612	VBP1	chrX	154448459	290	35	ILTRYAFPLAHSLEDVDSFMKQPGNE
MTM1	chrX	149787612	VBP1	chrX	154448459	363	111	ILTRYAFPLAHSLEDVDSFMKQPGNE
MTM1	chrX	149787612	VBP1	chrX	154448459	401	72	ILTRYAFPLAHSLEDVDSFMKQPGNE
MTM1	chrX	149787612	VBP1	chrX	154448459	498	148	ILTRYAFPLAHSLEDVDSFMKQPGNE
MTM1	chrX	149787612	VBP1	chrX	154448460	290	35	ILTRYAFPLAHSLEDVDSFMKQPGNE
MTM1	chrX	149787612	VBP1	chrX	154448460	363	111	ILTRYAFPLAHSLEDVDSFMKQPGNE
MTM1	chrX	149787612	VBP1	chrX	154448460	401	72	ILTRYAFPLAHSLEDVDSFMKQPGNE
MTM1	chrX	149787612	VBP1	chrX	154448460	498	148	ILTRYAFPLAHSLEDVDSFMKQPGNE

Top

Potential FusionNeoAntigen Information of MTM1-VBP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MTM1-VBP1_149787612_154448459.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B15:17	HSLEDVDSF	0.9885	0.8942	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B15:16	HSLEDVDSF	0.9838	0.5146	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B58:01	HSLEDVDSF	0.9807	0.7907	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:08	HSLEDVDSF	0.9703	0.8665	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B58:02	HSLEDVDSF	0.97	0.7954	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B57:03	HSLEDVDSF	0.9647	0.8889	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:01	HSLEDVDSF	0.9281	0.8777	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B15:18	AHSLEDVDSF	0.9822	0.7344	9	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B51:02	FPLAHSLEDV	0.972	0.6169	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B38:02	AHSLEDVDSF	0.9706	0.977	9	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B38:01	AHSLEDVDSF	0.9677	0.9756	9	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B51:01	FPLAHSLEDV	0.9154	0.5943	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B38:02	AHSLEDVDSFM	0.999	0.9733	9	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B38:01	AHSLEDVDSFM	0.999	0.9728	9	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-C05:09	SLEDVDSFM	0.9991	0.8319	11	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-C08:15	SLEDVDSFM	0.9979	0.9043	11	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B15:31	HSLEDVDSF	0.9345	0.8943	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-A02:07	SLEDVDSFM	0.8885	0.6019	11	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B54:01	FPLAHSLEDV	0.997	0.5359	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B39:05	AHSLEDVDSF	0.9683	0.9038	9	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B78:01	FPLAHSLEDV	0.9582	0.6375	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-C05:01	SLEDVDSFM	0.9991	0.8319	11	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-C04:03	SLEDVDSFM	0.999	0.6826	11	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-C08:02	SLEDVDSFM	0.9979	0.9043	11	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B57:04	HSLEDVDSF	0.9929	0.7154	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B57:02	HSLEDVDSF	0.9771	0.8692	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B58:06	HSLEDVDSF	0.9763	0.5984	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:11	HSLEDVDSF	0.9708	0.8845	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:28	HSLEDVDSF	0.9298	0.9044	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:77	HSLEDVDSF	0.9281	0.8777	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:20	HSLEDVDSF	0.9253	0.912	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:23	HSLEDVDSF	0.9251	0.8517	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:43	HSLEDVDSF	0.879	0.8441	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:13	HSLEDVDSF	0.8288	0.913	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B35:24	HSLEDVDSF	0.5056	0.9001	10	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B38:05	AHSLEDVDSF	0.9677	0.9756	9	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B57:02	AHSLEDVDSF	0.9581	0.9405	9	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B78:02	FPLAHSLEDV	0.9446	0.692	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B51:09	FPLAHSLEDV	0.9245	0.6052	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B51:14	FPLAHSLEDV	0.9166	0.6325	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B51:13	FPLAHSLEDV	0.9119	0.5248	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B39:11	AHSLEDVDSF	0.8904	0.8461	9	19
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B51:29	FPLAHSLEDV	0.8379	0.5185	6	16
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B38:05	AHSLEDVDSFM	0.999	0.9728	9	20
MTM1-VBP1	chrX	149787612	chrX	154448459	498	HLA-B39:11	AHSLEDVDSFM	0.9941	0.8414	9	20

Top

Potential FusionNeoAntigen Information of MTM1-VBP1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of MTM1-VBP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2501	FPLAHSLEDVDSFM	MTM1	VBP1	chrX	149787612	chrX	154448459	498

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MTM1-VBP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2501	FPLAHSLEDVDSFM	-6.35597	-6.46937
HLA-B14:02	3BVN	2501	FPLAHSLEDVDSFM	-5.80319	-6.83849
HLA-B52:01	3W39	2501	FPLAHSLEDVDSFM	-6.67268	-6.78608
HLA-B52:01	3W39	2501	FPLAHSLEDVDSFM	-5.72753	-6.76283
HLA-A11:01	4UQ2	2501	FPLAHSLEDVDSFM	-7.31441	-7.42781
HLA-A11:01	4UQ2	2501	FPLAHSLEDVDSFM	-7.25126	-8.28656
HLA-A24:02	5HGA	2501	FPLAHSLEDVDSFM	-8.41244	-8.52584
HLA-A24:02	5HGA	2501	FPLAHSLEDVDSFM	-5.27978	-6.31508
HLA-B44:05	3DX8	2501	FPLAHSLEDVDSFM	-4.03348	-4.14688
HLA-B44:05	3DX8	2501	FPLAHSLEDVDSFM	-3.56413	-4.59943
HLA-A02:01	6TDR	2501	FPLAHSLEDVDSFM	-6.72173	-7.75703

Top

Vaccine Design for the FusionNeoAntigens of MTM1-VBP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MTM1-VBP1	chrX	149787612	chrX	154448459	10	19	HSLEDVDSF	CACAGTCTGGAAGATGTAGATTCCTTC
MTM1-VBP1	chrX	149787612	chrX	154448459	11	20	SLEDVDSFM	AGTCTGGAAGATGTAGATTCCTTCATG
MTM1-VBP1	chrX	149787612	chrX	154448459	6	16	FPLAHSLEDV	TTTCCCCTGGCTCACAGTCTGGAAGATGTA
MTM1-VBP1	chrX	149787612	chrX	154448459	9	19	AHSLEDVDSF	GCTCACAGTCTGGAAGATGTAGATTCCTTC
MTM1-VBP1	chrX	149787612	chrX	154448459	9	20	AHSLEDVDSFM	GCTCACAGTCTGGAAGATGTAGATTCCTTCATG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of MTM1-VBP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	MTM1-VBP1	chrX	149787612	ENST00000370396	chrX	154448459	ENST00000286428	TCGA-55-6712

Top

Potential target of CAR-T therapy development for MTM1-VBP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MTM1-VBP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MTM1-VBP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)