|
|||||||
|
Fusion Protein:MTR-IFI16 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: MTR-IFI16 | FusionPDB ID: 55866 | FusionGDB2.0 ID: 55866 | Hgene | Tgene | Gene symbol | MTR | IFI16 | Gene ID | 4548 | 3428 |
| Gene name | 5-methyltetrahydrofolate-homocysteine methyltransferase | interferon gamma inducible protein 16 | |
| Synonyms | HMAG|MS|cblG | IFNGIP1|PYHIN2 | |
| Cytomap | 1q43 | 1q23.1 | |
| Type of gene | protein-coding | protein-coding | |
| Description | methionine synthase5-methyltetrahydrofolate-homocysteine methyltransferase 1cobalamin-dependent methionine synthasevitamin-B12 dependent methionine synthase | gamma-interferon-inducible protein 16IFI16 beta isoforminterferon-gamma induced protein IFI 16interferon-inducible myeloid differentiation transcriptional activator | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q9UBK8 Main function of 5'-partner protein: FUNCTION: Key enzyme in methionine and folate homeostasis responsible for the reactivation of methionine synthase (MTR/MS) activity by catalyzing the reductive methylation of MTR-bound cob(II)alamin (PubMed:17892308). Cobalamin (vitamin B12) forms a complex with MTR to serve as an intermediary in methyl transfer reactions that cycles between MTR-bound methylcob(III)alamin and MTR bound-cob(I)alamin forms, and occasional oxidative escape of the cob(I)alamin intermediate during the catalytic cycle leads to the inactive cob(II)alamin species (Probable). The processing of cobalamin in the cytosol occurs in a multiprotein complex composed of at least MMACHC, MMADHC, MTRR and MTR which may contribute to shuttle safely and efficiently cobalamin towards MTR in order to produce methionine (PubMed:27771510). Also necessary for the utilization of methyl groups from the folate cycle, thereby affecting transgenerational epigenetic inheritance (By similarity). Also acts as a molecular chaperone for methionine synthase by stabilizing apoMTR and incorporating methylcob(III)alamin into apoMTR to form the holoenzyme (PubMed:16769880). Also serves as an aquacob(III)alamin reductase by reducing aquacob(III)alamin to cob(II)alamin; this reduction leads to stimulation of the conversion of apoMTR and aquacob(III)alamin to MTR holoenzyme (PubMed:16769880). {ECO:0000250|UniProtKB:Q8C1A3, ECO:0000269|PubMed:16769880, ECO:0000269|PubMed:17892308, ECO:0000269|PubMed:27771510, ECO:0000305|PubMed:19243433}. | Q16666 Main function of 5'-partner protein: FUNCTION: Binds double-stranded DNA. Binds preferentially to supercoiled DNA and cruciform DNA structures. Seems to be involved in transcriptional regulation. May function as a transcriptional repressor. Could have a role in the regulation of hematopoietic differentiation through activation of unknown target genes. Controls cellular proliferation by modulating the functions of cell cycle regulatory factors including p53/TP53 and the retinoblastoma protein. May be involved in TP53-mediated transcriptional activation by enhancing TP53 sequence-specific DNA binding and modulating TP53 phosphorylation status. Seems to be involved in energy-level-dependent activation of the ATM/ AMPK/TP53 pathway coupled to regulation of autophagy. May be involved in regulation of TP53-mediated cell death also involving BRCA1. May be involved in the senescence of prostate epithelial cells. Involved in innate immune response by recognizing viral dsDNA in the cytosol and probably in the nucleus. After binding to viral DNA in the cytoplasm recruits TMEM173/STING and mediates the induction of IFN-beta. Has anti-inflammatory activity and inhibits the activation of the AIM2 inflammasome, probably via association with AIM2. Proposed to bind viral DNA in the nucleus, such as of Kaposi's sarcoma-associated herpesvirus, and to induce the formation of nuclear caspase-1-activating inflammasome formation via association with PYCARD. Inhibits replication of herpesviruses such as human cytomegalovirus (HCMV) probably by interfering with promoter recruitment of members of the Sp1 family of transcription factors. Necessary to activate the IRF3 signaling cascade during human herpes simplex virus 1 (HHV-1) infection and promotes the assembly of heterochromatin on herpesviral DNA and inhibition of viral immediate-early gene expression and replication. Involved in the MTA1-mediated epigenetic regulation of ESR1 expression in breast cancer. {ECO:0000269|PubMed:11146555, ECO:0000269|PubMed:12894224, ECO:0000269|PubMed:14654789, ECO:0000269|PubMed:20890285, ECO:0000269|PubMed:21573174, ECO:0000269|PubMed:21575908, ECO:0000269|PubMed:22046441, ECO:0000269|PubMed:22291595, ECO:0000269|PubMed:23027953, ECO:0000269|PubMed:24198334, ECO:0000269|PubMed:24413532, ECO:0000269|PubMed:9642285}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000366577, ENST00000535889, ENST00000418145, ENST00000470570, | ENST00000295809, ENST00000340979, ENST00000359709, ENST00000368131, ENST00000368132, ENST00000430894, ENST00000448393, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 6 X 6 X 3=108 | 12 X 13 X 7=1092 |
| # samples | 7 | 15 | |
| ** MAII score | log2(7/108*10)=-0.625604485218502 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(15/1092*10)=-2.86393845042397 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: MTR [Title/Abstract] AND IFI16 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: MTR [Title/Abstract] AND IFI16 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MTR(237001899)-IFI16(159019222), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | MTR-IFI16 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MTR-IFI16 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MTR-IFI16 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MTR-IFI16 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | IFI16 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 12894224|24413532 |
| Tgene | IFI16 | GO:0002218 | activation of innate immune response | 21575908 |
| Tgene | IFI16 | GO:0030224 | monocyte differentiation | 9766636 |
| Tgene | IFI16 | GO:0032731 | positive regulation of interleukin-1 beta production | 21575908 |
| Tgene | IFI16 | GO:0042149 | cellular response to glucose starvation | 21573174 |
| Tgene | IFI16 | GO:0042771 | intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator | 14654789 |
| Tgene | IFI16 | GO:0043392 | negative regulation of DNA binding | 22291595 |
| Tgene | IFI16 | GO:0045071 | negative regulation of viral genome replication | 22291595 |
| Tgene | IFI16 | GO:0045824 | negative regulation of innate immune response | 22046441 |
| Tgene | IFI16 | GO:0045892 | negative regulation of transcription, DNA-templated | 9642285 |
| Tgene | IFI16 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 11146555 |
| Tgene | IFI16 | GO:0051607 | defense response to virus | 21478870 |
| Tgene | IFI16 | GO:0071479 | cellular response to ionizing radiation | 14654789 |
| Tgene | IFI16 | GO:2000117 | negative regulation of cysteine-type endopeptidase activity | 22046441 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:237001899/chr1:159019222) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across MTR (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across IFI16 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000366577 | MTR | chr1 | 237001899 | - | ENST00000340979 | IFI16 | chr1 | 159021469 | + | 2854 | 1909 | 301 | 2601 | 766 |
| ENST00000366577 | MTR | chr1 | 237001899 | - | ENST00000368131 | IFI16 | chr1 | 159021469 | + | 2856 | 1909 | 301 | 2601 | 766 |
| ENST00000366577 | MTR | chr1 | 237001899 | - | ENST00000368132 | IFI16 | chr1 | 159021469 | + | 2852 | 1909 | 301 | 2601 | 766 |
| ENST00000366577 | MTR | chr1 | 237001899 | - | ENST00000295809 | IFI16 | chr1 | 159021469 | + | 2856 | 1909 | 301 | 2601 | 766 |
| ENST00000366577 | MTR | chr1 | 237001899 | - | ENST00000430894 | IFI16 | chr1 | 159021469 | + | 2849 | 1909 | 301 | 2601 | 766 |
| ENST00000366577 | MTR | chr1 | 237001899 | - | ENST00000359709 | IFI16 | chr1 | 159021469 | + | 2849 | 1909 | 301 | 2601 | 766 |
| ENST00000366577 | MTR | chr1 | 237001899 | - | ENST00000448393 | IFI16 | chr1 | 159021469 | + | 2825 | 1909 | 301 | 2601 | 766 |
| ENST00000535889 | MTR | chr1 | 237001899 | - | ENST00000340979 | IFI16 | chr1 | 159021469 | + | 2482 | 1537 | 22 | 2229 | 735 |
| ENST00000535889 | MTR | chr1 | 237001899 | - | ENST00000368131 | IFI16 | chr1 | 159021469 | + | 2484 | 1537 | 22 | 2229 | 735 |
| ENST00000535889 | MTR | chr1 | 237001899 | - | ENST00000368132 | IFI16 | chr1 | 159021469 | + | 2480 | 1537 | 22 | 2229 | 735 |
| ENST00000535889 | MTR | chr1 | 237001899 | - | ENST00000295809 | IFI16 | chr1 | 159021469 | + | 2484 | 1537 | 22 | 2229 | 735 |
| ENST00000535889 | MTR | chr1 | 237001899 | - | ENST00000430894 | IFI16 | chr1 | 159021469 | + | 2477 | 1537 | 22 | 2229 | 735 |
| ENST00000535889 | MTR | chr1 | 237001899 | - | ENST00000359709 | IFI16 | chr1 | 159021469 | + | 2477 | 1537 | 22 | 2229 | 735 |
| ENST00000535889 | MTR | chr1 | 237001899 | - | ENST00000448393 | IFI16 | chr1 | 159021469 | + | 2453 | 1537 | 22 | 2229 | 735 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000366577 | ENST00000340979 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000975812 | 0.99902415 |
| ENST00000366577 | ENST00000368131 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000979442 | 0.9990206 |
| ENST00000366577 | ENST00000368132 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000982096 | 0.99901783 |
| ENST00000366577 | ENST00000295809 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000979442 | 0.9990206 |
| ENST00000366577 | ENST00000430894 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000983399 | 0.99901664 |
| ENST00000366577 | ENST00000359709 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000983399 | 0.99901664 |
| ENST00000366577 | ENST00000448393 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.001117378 | 0.9988826 |
| ENST00000535889 | ENST00000340979 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000877791 | 0.9991222 |
| ENST00000535889 | ENST00000368131 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000882524 | 0.99911743 |
| ENST00000535889 | ENST00000368132 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000883561 | 0.9991165 |
| ENST00000535889 | ENST00000295809 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000882524 | 0.99911743 |
| ENST00000535889 | ENST00000430894 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000880699 | 0.99911934 |
| ENST00000535889 | ENST00000359709 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.000880699 | 0.99911934 |
| ENST00000535889 | ENST00000448393 | MTR | chr1 | 237001899 | - | IFI16 | chr1 | 159021469 | + | 0.001002231 | 0.99899775 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MTR-IFI16 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| MTR | chr1 | 237001899 | IFI16 | chr1 | 159021469 | 1537 | 505 | AAMVVMAFDEEGQLKPRLKTEPEEVS |
| MTR | chr1 | 237001899 | IFI16 | chr1 | 159021469 | 1909 | 536 | AAMVVMAFDEEGQLKPRLKTEPEEVS |
Top |
Potential FusionNeoAntigen Information of MTR-IFI16 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| MTR-IFI16_237001899_159021469.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B44:03 | EEGQLKPRL | 0.9943 | 0.8464 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:03 | MAFDEEGQL | 0.9871 | 0.8968 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:01 | MAFDEEGQL | 0.9786 | 0.9383 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:04 | MAFDEEGQL | 0.9542 | 0.9659 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:02 | MAFDEEGQL | 0.9542 | 0.9659 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B18:01 | EEGQLKPRL | 0.9095 | 0.8411 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C04:10 | AFDEEGQL | 1 | 0.6879 | 6 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C04:07 | AFDEEGQL | 1 | 0.7211 | 6 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C04:14 | AFDEEGQL | 0.9928 | 0.7556 | 6 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:19 | MAFDEEGQL | 0.9997 | 0.9879 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:07 | MAFDEEGQL | 0.9996 | 0.9798 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:08 | MAFDEEGQL | 0.9995 | 0.9135 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C04:06 | MAFDEEGQL | 0.9974 | 0.8908 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C08:04 | MAFDEEGQL | 0.9923 | 0.9642 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C08:13 | MAFDEEGQL | 0.9923 | 0.9642 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C12:12 | MAFDEEGQL | 0.9893 | 0.9466 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C06:03 | MAFDEEGQL | 0.9815 | 0.994 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C08:03 | MAFDEEGQL | 0.981 | 0.9839 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C12:04 | MAFDEEGQL | 0.9805 | 0.9936 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:12 | MAFDEEGQL | 0.9542 | 0.9659 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:14 | MAFDEEGQL | 0.943 | 0.9798 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C02:06 | MAFDEEGQL | 0.9318 | 0.9492 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C04:01 | AFDEEGQL | 1 | 0.7211 | 6 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C04:03 | AFDEEGQL | 1 | 0.768 | 6 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C18:01 | AFDEEGQL | 0.9999 | 0.7274 | 6 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C04:04 | AFDEEGQL | 0.9977 | 0.9167 | 6 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:04 | MAFDEEGQL | 0.9997 | 0.9887 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:03 | MAFDEEGQL | 0.9997 | 0.9887 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:17 | MAFDEEGQL | 0.9995 | 0.9725 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:05 | MAFDEEGQL | 0.9994 | 0.936 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:02 | MAFDEEGQL | 0.9986 | 0.976 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C16:04 | MAFDEEGQL | 0.9975 | 0.9839 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C03:06 | MAFDEEGQL | 0.9951 | 0.988 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B44:13 | EEGQLKPRL | 0.9943 | 0.8464 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B44:26 | EEGQLKPRL | 0.9943 | 0.8464 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B44:07 | EEGQLKPRL | 0.9943 | 0.8464 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C12:02 | MAFDEEGQL | 0.994 | 0.9724 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B40:04 | EEGQLKPRL | 0.994 | 0.5883 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C12:03 | MAFDEEGQL | 0.9916 | 0.9813 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:13 | MAFDEEGQL | 0.9856 | 0.8984 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C08:01 | MAFDEEGQL | 0.981 | 0.9839 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:77 | MAFDEEGQL | 0.9786 | 0.9383 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:23 | MAFDEEGQL | 0.9774 | 0.9435 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B35:09 | MAFDEEGQL | 0.9542 | 0.9659 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C02:02 | MAFDEEGQL | 0.9238 | 0.9693 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C02:10 | MAFDEEGQL | 0.9238 | 0.9693 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B18:05 | EEGQLKPRL | 0.9095 | 0.8411 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B18:06 | EEGQLKPRL | 0.9035 | 0.842 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B51:06 | MAFDEEGQL | 0.8901 | 0.5325 | 5 | 14 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B18:03 | EEGQLKPRL | 0.8604 | 0.8308 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-B18:11 | EEGQLKPRL | 0.7806 | 0.7301 | 9 | 18 |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 | HLA-C17:01 | MAFDEEGQL | 0.7352 | 0.867 | 5 | 14 |
Top |
Potential FusionNeoAntigen Information of MTR-IFI16 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of MTR-IFI16 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 186 | AFDEEGQLKPRLKT | MTR | IFI16 | chr1 | 237001899 | chr1 | 159021469 | 1909 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MTR-IFI16 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 186 | AFDEEGQLKPRLKT | -4.62424 | -5.65954 |
| HLA-B14:02 | 3BVN | 186 | AFDEEGQLKPRLKT | -4.1114 | -4.2248 |
| HLA-B52:01 | 3W39 | 186 | AFDEEGQLKPRLKT | -6.8001 | -6.9135 |
| HLA-B52:01 | 3W39 | 186 | AFDEEGQLKPRLKT | -6.46104 | -7.49634 |
| HLA-A24:02 | 5HGA | 186 | AFDEEGQLKPRLKT | -9.1447 | -9.2581 |
| HLA-A24:02 | 5HGA | 186 | AFDEEGQLKPRLKT | -6.01279 | -7.04809 |
| HLA-B44:05 | 3DX8 | 186 | AFDEEGQLKPRLKT | -5.02862 | -5.14202 |
| HLA-B44:05 | 3DX8 | 186 | AFDEEGQLKPRLKT | -4.60714 | -5.64244 |
Top |
Vaccine Design for the FusionNeoAntigens of MTR-IFI16 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 5 | 14 | MAFDEEGQL | ATGGCTTTTGATGAAGAAGGACAGTTG |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 6 | 14 | AFDEEGQL | GCTTTTGATGAAGAAGGACAGTTG |
| MTR-IFI16 | chr1 | 237001899 | chr1 | 159021469 | 9 | 18 | EEGQLKPRL | GAAGAAGGACAGTTGAAACCAAGACTG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of MTR-IFI16 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| BRCA | MTR-IFI16 | chr1 | 237001899 | ENST00000366577 | chr1 | 159021469 | ENST00000295809 | TCGA-A8-A07O-01A |
Top |
Potential target of CAR-T therapy development for MTR-IFI16 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MTR-IFI16 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MTR-IFI16 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies