Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MUC1-PKLR

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MUC1-PKLR
	FusionPDB ID: 56008
	FusionGDB2.0 ID: 56008
		Hgene	Tgene
	Gene symbol	MUC1	PKLR
	Gene ID	4582	5313
	Gene name	mucin 1, cell surface associated	pyruvate kinase L/R
	Synonyms	ADMCKD\|ADMCKD1\|CA 15-3\|CD227\|EMA\|H23AG\|KL-6\|MAM6\|MCD\|MCKD\|MCKD1\|MUC-1\|MUC-1/SEC\|MUC-1/X\|MUC1/ZD\|PEM\|PEMT\|PUM	PK1\|PKL\|PKRL\|RPK
	Cytomap	1q22	1q22
	Type of gene	protein-coding	protein-coding
	Description	mucin-1H23 antigenbreast carcinoma-associated antigen DF3cancer antigen 15-3carcinoma-associated mucinepisialinkrebs von den Lungen-6mucin 1, transmembranepeanut-reactive urinary mucinpolymorphic epithelial mucintumor associated epithelial mucin	pyruvate kinase PKLRR-type/L-type pyruvate kinasepyruvate kinase 1pyruvate kinase isozyme R/Lpyruvate kinase isozymes L/Rpyruvate kinase isozymes R/Lpyruvate kinase type Lpyruvate kinase, liver and RBCpyruvate kinase, liver and blood cellred cell
	Modification date	20200327	20200313
	UniProtAcc	Q7Z5P9 Main function of 5'-partner protein: FUNCTION: May function in ocular mucus homeostasis. {ECO:0000269\|PubMed:18184611}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000462215, ENST00000337604, ENST00000338684, ENST00000342482, ENST00000343256, ENST00000368389, ENST00000368390, ENST00000368392, ENST00000368393, ENST00000368396, ENST00000368398, ENST00000438413, ENST00000457295, ENST00000368395,	ENST00000342741, ENST00000392414,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 8 X 3=168	3 X 3 X 3=27
	# samples	9	3
	** MAII score	log2(9/168*10)=-0.900464326449086 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: MUC1 [Title/Abstract] AND PKLR [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MUC1 [Title/Abstract] AND PKLR [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MUC1(155161974)-PKLR(155263381), # samples:3
Anticipated loss of major functional domain due to fusion event.	MUC1-PKLR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MUC1-PKLR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MUC1-PKLR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MUC1-PKLR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	MUC1	GO:0006977	DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	15710329
Hgene	MUC1	GO:0006978	DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator	15710329
Hgene	MUC1	GO:0010944	negative regulation of transcription by competitive promoter binding	15710329
Hgene	MUC1	GO:0033629	negative regulation of cell adhesion mediated by integrin	7698991
Hgene	MUC1	GO:0036003	positive regulation of transcription from RNA polymerase II promoter in response to stress	15710329
Hgene	MUC1	GO:0043618	regulation of transcription from RNA polymerase II promoter in response to stress	15710329
Hgene	MUC1	GO:0090240	positive regulation of histone H4 acetylation	15710329
Hgene	MUC1	GO:1902166	negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator	15710329

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:155161974/chr1:155263381)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MUC1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PKLR (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000338684	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1594	252	24	860	278
ENST00000338684	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1180	252	24	860	278
ENST00000438413	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1551	209	8	817	269
ENST00000438413	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1137	209	8	817	269
ENST00000457295	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1578	236	8	844	278
ENST00000457295	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1164	236	8	844	278
ENST00000368392	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1578	236	8	844	278
ENST00000368392	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1164	236	8	844	278
ENST00000368393	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1551	209	8	817	269
ENST00000368393	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1137	209	8	817	269
ENST00000368390	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1525	183	24	791	255
ENST00000368390	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1111	183	24	791	255
ENST00000368396	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1552	210	24	818	264
ENST00000368396	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1138	210	24	818	264
ENST00000343256	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1525	183	24	791	255
ENST00000343256	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1111	183	24	791	255
ENST00000368398	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1525	183	24	791	255
ENST00000368398	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1111	183	24	791	255
ENST00000368389	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1525	183	24	791	255
ENST00000368389	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1111	183	24	791	255
ENST00000342482	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1552	210	24	818	264
ENST00000342482	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1138	210	24	818	264
ENST00000337604	MUC1	chr1	155161974	-	ENST00000392414	PKLR	chr1	155263381	-	1526	184	25	792	255
ENST00000337604	MUC1	chr1	155161974	-	ENST00000342741	PKLR	chr1	155263381	-	1112	184	25	792	255

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000338684	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.039675884	0.9603241
ENST00000338684	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.045165654	0.9548343
ENST00000438413	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.01577788	0.9842221
ENST00000438413	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.019860186	0.9801398
ENST00000457295	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.039577577	0.96042246
ENST00000457295	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.043315582	0.9566844
ENST00000368392	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.039577577	0.96042246
ENST00000368392	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.043315582	0.9566844
ENST00000368393	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.01577788	0.9842221
ENST00000368393	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.019860186	0.9801398
ENST00000368390	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.013730447	0.98626953
ENST00000368390	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.017791288	0.9822088
ENST00000368396	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.037507508	0.96249247
ENST00000368396	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.041453704	0.95854634
ENST00000343256	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.013730447	0.98626953
ENST00000343256	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.017791288	0.9822088
ENST00000368398	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.013730447	0.98626953
ENST00000368398	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.017791288	0.9822088
ENST00000368389	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.013730447	0.98626953
ENST00000368389	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.017791288	0.9822088
ENST00000342482	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.037507508	0.96249247
ENST00000342482	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.041453704	0.95854634
ENST00000337604	ENST00000392414	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.014169941	0.98583
ENST00000337604	ENST00000342741	MUC1	chr1	155161974	-	PKLR	chr1	155263381	-	0.018205965	0.981794

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MUC1-PKLR

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MUC1	chr1	155161974	PKLR	chr1	155263381	183	53	QRSSVPSSTEKNAMLESMITKPRPTR
MUC1	chr1	155161974	PKLR	chr1	155263381	184	53	QRSSVPSSTEKNAMLESMITKPRPTR
MUC1	chr1	155161974	PKLR	chr1	155263381	209	67	QRSSVPSSTEKNAMLESMITKPRPTR
MUC1	chr1	155161974	PKLR	chr1	155263381	210	62	QRSSVPSSTEKNAMLESMITKPRPTR
MUC1	chr1	155161974	PKLR	chr1	155263381	236	76	QRSSVPSSTEKNAMLESMITKPRPTR
MUC1	chr1	155161974	PKLR	chr1	155263381	252	76	QRSSVPSSTEKNAMLESMITKPRPTR

Top

Potential FusionNeoAntigen Information of MUC1-PKLR in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MUC1-PKLR_155161974_155263381.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B15:37	EKNAMLESM	0.6003	0.6368	9	18
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:08	VPSSTEKNAM	0.9261	0.9066	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:01	VPSSTEKNAM	0.8741	0.9343	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:03	VPSSTEKNAM	0.7518	0.9436	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:02	VPSSTEKNAM	0.4229	0.9697	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:04	VPSSTEKNAM	0.4229	0.9697	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A74:11	AMLESMITKPR	0.9835	0.6956	12	23
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A74:03	AMLESMITKPR	0.9835	0.6956	12	23
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A74:09	AMLESMITKPR	0.9835	0.6956	12	23
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A74:03	KNAMLESMITK	0.9182	0.5328	10	21
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A74:09	KNAMLESMITK	0.9182	0.5328	10	21
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A74:11	KNAMLESMITK	0.9182	0.5328	10	21
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C03:07	SSTEKNAML	0.9986	0.992	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C03:08	SSTEKNAML	0.9983	0.9594	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C15:06	SSTEKNAML	0.9982	0.9567	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C01:17	SSTEKNAML	0.9938	0.9489	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C01:30	SSTEKNAML	0.797	0.9666	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C02:06	SSTEKNAML	0.5605	0.9862	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B07:12	VPSSTEKNAM	0.9776	0.551	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B39:10	VPSSTEKNAM	0.4398	0.9379	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:12	VPSSTEKNAM	0.4229	0.9697	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C01:17	SVPSSTEKNAM	0.9853	0.9287	3	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C16:01	SSTEKNAM	0.9724	0.9765	6	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C03:03	SSTEKNAML	0.9984	0.995	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C03:04	SSTEKNAML	0.9984	0.995	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C15:05	SSTEKNAML	0.998	0.9281	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C15:02	SSTEKNAML	0.9979	0.934	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C03:17	SSTEKNAML	0.9951	0.9829	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C01:02	SSTEKNAML	0.9934	0.9459	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C01:03	SSTEKNAML	0.9901	0.9295	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C03:06	SSTEKNAML	0.9665	0.9949	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A30:01	AMLESMITK	0.9413	0.6849	12	21
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C16:01	SSTEKNAML	0.744	0.9815	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C16:02	SSTEKNAML	0.7195	0.993	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C17:01	SSTEKNAML	0.2473	0.8706	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B07:13	SSTEKNAML	0.0185	0.8632	6	15
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:23	VPSSTEKNAM	0.8797	0.9245	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:77	VPSSTEKNAM	0.8741	0.9343	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B35:09	VPSSTEKNAM	0.4229	0.9697	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-B67:01	VPSSTEKNAM	0.4103	0.7756	4	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-C01:02	SVPSSTEKNAM	0.99	0.9238	3	14
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A74:01	AMLESMITKPR	0.9835	0.6956	12	23
MUC1-PKLR	chr1	155161974	chr1	155263381	184	HLA-A74:01	KNAMLESMITK	0.9182	0.5328	10	21

Top

Potential FusionNeoAntigen Information of MUC1-PKLR in HLA II

MUC1-PKLR_155161974_155263381.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0101	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0102	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0104	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0105	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0106	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0106	KNAMLESMITKPRPT	10	25
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0108N	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0113	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0114	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0202	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0202	KNAMLESMITKPRPT	10	25
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0204	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0204	KNAMLESMITKPRPT	10	25
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0205	NAMLESMITKPRPTR	11	26
MUC1-PKLR	chr1	155161974	chr1	155263381	184	DRB5-0205	KNAMLESMITKPRPT	10	25

Top

Fusion breakpoint peptide structures of MUC1-PKLR

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9068	SSTEKNAMLESMIT	MUC1	PKLR	chr1	155161974	chr1	155263381	184

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MUC1-PKLR

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9068	SSTEKNAMLESMIT	-7.24289	-7.35629
HLA-B14:02	3BVN	9068	SSTEKNAMLESMIT	-6.44411	-7.47941
HLA-B52:01	3W39	9068	SSTEKNAMLESMIT	-6.85231	-6.96571
HLA-B52:01	3W39	9068	SSTEKNAMLESMIT	-5.09533	-6.13063
HLA-A11:01	4UQ2	9068	SSTEKNAMLESMIT	-8.61576	-8.72916
HLA-A24:02	5HGA	9068	SSTEKNAMLESMIT	-6.80714	-7.84244
HLA-A24:02	5HGA	9068	SSTEKNAMLESMIT	-6.33574	-6.44914
HLA-B44:05	3DX8	9068	SSTEKNAMLESMIT	-7.01739	-7.13079
HLA-B44:05	3DX8	9068	SSTEKNAMLESMIT	-3.37818	-4.41348

Top

Vaccine Design for the FusionNeoAntigens of MUC1-PKLR

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MUC1-PKLR	chr1	155161974	chr1	155263381	10	21	KNAMLESMITK	AAGAATGCTATGCTGGAGAGCATGATTACCAAG
MUC1-PKLR	chr1	155161974	chr1	155263381	12	21	AMLESMITK	GCTATGCTGGAGAGCATGATTACCAAG
MUC1-PKLR	chr1	155161974	chr1	155263381	12	23	AMLESMITKPR	GCTATGCTGGAGAGCATGATTACCAAGCCCCGG
MUC1-PKLR	chr1	155161974	chr1	155263381	3	14	SVPSSTEKNAM	TCAGTGCCCAGCTCTACTGAGAAGAATGCTATG
MUC1-PKLR	chr1	155161974	chr1	155263381	4	14	VPSSTEKNAM	GTGCCCAGCTCTACTGAGAAGAATGCTATG
MUC1-PKLR	chr1	155161974	chr1	155263381	6	14	SSTEKNAM	AGCTCTACTGAGAAGAATGCTATG
MUC1-PKLR	chr1	155161974	chr1	155263381	6	15	SSTEKNAML	AGCTCTACTGAGAAGAATGCTATGCTG
MUC1-PKLR	chr1	155161974	chr1	155263381	9	18	EKNAMLESM	GAGAAGAATGCTATGCTGGAGAGCATG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
MUC1-PKLR	chr1	155161974	chr1	155263381	10	25	KNAMLESMITKPRPT	AAGAATGCTATGCTGGAGAGCATGATTACCAAGCCCCGGCCAACG
MUC1-PKLR	chr1	155161974	chr1	155263381	11	26	NAMLESMITKPRPTR	AATGCTATGCTGGAGAGCATGATTACCAAGCCCCGGCCAACGAGG

Top

Information of the samples that have these potential fusion neoantigens of MUC1-PKLR

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	MUC1-PKLR	chr1	155161974	ENST00000337604	chr1	155263381	ENST00000342741	TCGA-91-A4BD-01A

Top

Potential target of CAR-T therapy development for MUC1-PKLR

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MUC1-PKLR

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MUC1-PKLR

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)