Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:MVB12B-MED27

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: MVB12B-MED27
	FusionPDB ID: 56087
	FusionGDB2.0 ID: 56087
		Hgene	Tgene
	Gene symbol	MVB12B	MED27
	Gene ID	89853	9442
	Gene name	multivesicular body subunit 12B	mediator complex subunit 27
	Synonyms	C9orf28\|FAM125B	CRAP34\|CRSP34\|CRSP8\|MED3\|TRAP37
	Cytomap	9q33.3	9q34.13
	Type of gene	protein-coding	protein-coding
	Description	multivesicular body subunit 12BESCRT-I complex subunit MVB12Bfamily with sequence similarity 125, member B	mediator of RNA polymerase II transcription subunit 27CRSP complex subunit 8cofactor required for Sp1 transcriptional activation, subunit 8, 34kDaepididymis secretory sperm binding proteinp37 TRAP/SMCC/PC2 subunittranscriptional coactivator CRSP34
	Modification date	20200313	20200313
	UniProtAcc	Q9H7P6 Main function of 5'-partner protein: FUNCTION: Component of the ESCRT-I complex, a regulator of vesicular trafficking process. Required for the sorting of endocytic ubiquitinated cargos into multivesicular bodies.	Q6P2C8 Main function of 5'-partner protein: FUNCTION: Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. {ECO:0000269\|PubMed:10882111, ECO:0000269\|PubMed:9989412}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000361171, ENST00000436593, ENST00000545391, ENST00000485886, ENST00000535766,	ENST00000474263, ENST00000292035, ENST00000357028,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	12 X 12 X 4=576	6 X 8 X 6=288
	# samples	13	10
	** MAII score	log2(13/576*10)=-2.14755718841386 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/288*10)=-1.52606881166759 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: MVB12B [Title/Abstract] AND MED27 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: MVB12B [Title/Abstract] AND MED27 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	MVB12B(129102909)-MED27(134889854), # samples:2
Anticipated loss of major functional domain due to fusion event.	MVB12B-MED27 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MVB12B-MED27 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MED27	GO:0006357	regulation of transcription by RNA polymerase II	9989412

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr9:129102909/chr9:134889854)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across MVB12B (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MED27 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000545391	MVB12B	chr9	129102909	+	ENST00000357028	MED27	chr9	134889854	-	1196	285	42	764	240
ENST00000545391	MVB12B	chr9	129102909	+	ENST00000292035	MED27	chr9	134889854	-	1304	285	42	872	276
ENST00000361171	MVB12B	chr9	129102909	+	ENST00000357028	MED27	chr9	134889854	-	1196	285	42	764	240
ENST00000361171	MVB12B	chr9	129102909	+	ENST00000292035	MED27	chr9	134889854	-	1304	285	42	872	276
ENST00000436593	MVB12B	chr9	129102909	+	ENST00000357028	MED27	chr9	134889854	-	1195	284	125	763	212
ENST00000436593	MVB12B	chr9	129102909	+	ENST00000292035	MED27	chr9	134889854	-	1303	284	125	871	248

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000545391	ENST00000357028	MVB12B	chr9	129102909	+	MED27	chr9	134889854	-	0.001516721	0.99848324
ENST00000545391	ENST00000292035	MVB12B	chr9	129102909	+	MED27	chr9	134889854	-	0.002278669	0.99772125
ENST00000361171	ENST00000357028	MVB12B	chr9	129102909	+	MED27	chr9	134889854	-	0.001516721	0.99848324
ENST00000361171	ENST00000292035	MVB12B	chr9	129102909	+	MED27	chr9	134889854	-	0.002278669	0.99772125
ENST00000436593	ENST00000357028	MVB12B	chr9	129102909	+	MED27	chr9	134889854	-	0.00249371	0.9975063
ENST00000436593	ENST00000292035	MVB12B	chr9	129102909	+	MED27	chr9	134889854	-	0.002408683	0.9975914

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for MVB12B-MED27

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
MVB12B	chr9	129102909	MED27	chr9	134889854	284	53	VASRNRAPTGYDVLQYHAGLASGLLN
MVB12B	chr9	129102909	MED27	chr9	134889854	285	81	VASRNRAPTGYDVLQYHAGLASGLLN

Top

Potential FusionNeoAntigen Information of MVB12B-MED27 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

MVB12B-MED27_129102909_134889854.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B39:01	NRAPTGYDVL	0.9977	0.8765	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B38:01	NRAPTGYDVL	0.9937	0.9206	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B38:02	NRAPTGYDVL	0.9933	0.9266	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B39:06	NRAPTGYDVL	0.9922	0.7497	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B14:01	NRAPTGYDVL	0.9871	0.8716	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B14:02	NRAPTGYDVL	0.9871	0.8716	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B35:01	APTGYDVLQY	0.9759	0.5962	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B35:08	APTGYDVLQY	0.9608	0.6551	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B15:37	NRAPTGYDVL	0.9253	0.5181	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-C01:17	RAPTGYDVL	0.6289	0.9762	5	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-C01:30	RAPTGYDVL	0.3335	0.9722	5	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B39:12	NRAPTGYDVL	0.9969	0.8832	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B39:05	NRAPTGYDVL	0.995	0.8496	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-C07:13	NRAPTGYDVL	0.994	0.9041	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B14:03	NRAPTGYDVL	0.9689	0.8914	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B73:01	NRAPTGYDVL	0.8491	0.6658	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B07:13	RAPTGYDVL	0.9522	0.927	5	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-C01:02	RAPTGYDVL	0.6344	0.976	5	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-C01:03	RAPTGYDVL	0.5442	0.9667	5	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B39:31	NRAPTGYDVL	0.998	0.8837	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B38:05	NRAPTGYDVL	0.9937	0.9206	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B35:77	APTGYDVLQY	0.9759	0.5962	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B39:11	NRAPTGYDVL	0.9756	0.9056	4	14
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B35:23	APTGYDVLQY	0.9754	0.6354	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B35:11	APTGYDVLQY	0.8918	0.7001	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B35:17	APTGYDVLQY	0.8852	0.5383	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B35:30	APTGYDVLQY	0.8852	0.5383	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B15:08	APTGYDVLQY	0.8235	0.6866	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B15:11	APTGYDVLQY	0.8225	0.6947	6	16
MVB12B-MED27	chr9	129102909	chr9	134889854	285	HLA-B35:43	APTGYDVLQY	0.8127	0.6893	6	16

Top

Potential FusionNeoAntigen Information of MVB12B-MED27 in HLA II

MVB12B-MED27_129102909_134889854.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1501	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1501	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1504	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1504	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1505	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1505	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1506	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1506	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1507	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1507	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1509	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1509	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1510	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1510	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1512	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1513	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1513	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1516	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1516	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1518	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1518	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1518	PTGYDVLQYHAGLAS	7	22
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1520	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1520	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1521	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1521	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1522	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1522	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1524	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1524	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1528	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1528	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1532	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1532	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1533	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1533	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1535	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1535	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1536	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1536	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1537	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1537	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1540	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1540	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1541	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1541	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1542	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1542	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1543	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1543	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1545	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1545	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1546	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1546	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1548	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1548	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1549	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB1-1549	GYDVLQYHAGLASGL	9	24
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB5-0204	TGYDVLQYHAGLASG	8	23
MVB12B-MED27	chr9	129102909	chr9	134889854	285	DRB5-0204	GYDVLQYHAGLASGL	9	24

Top

Fusion breakpoint peptide structures of MVB12B-MED27

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
505	APTGYDVLQYHAGL	MVB12B	MED27	chr9	129102909	chr9	134889854	285

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MVB12B-MED27

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	505	APTGYDVLQYHAGL	-7.14368	-7.25548
HLA-B14:02	3BVN	505	APTGYDVLQYHAGL	-6.90724	-7.95034
HLA-B52:01	3W39	505	APTGYDVLQYHAGL	-7.67666	-8.71976
HLA-B52:01	3W39	505	APTGYDVLQYHAGL	-5.5221	-5.6339
HLA-A11:01	4UQ2	505	APTGYDVLQYHAGL	-8.37369	-9.41679
HLA-A11:01	4UQ2	505	APTGYDVLQYHAGL	-6.26273	-6.37453
HLA-A24:02	5HGA	505	APTGYDVLQYHAGL	-7.6158	-8.6589
HLA-A24:02	5HGA	505	APTGYDVLQYHAGL	-5.36701	-5.47881
HLA-B44:05	3DX8	505	APTGYDVLQYHAGL	-8.09865	-8.21045
HLA-B44:05	3DX8	505	APTGYDVLQYHAGL	-5.97829	-7.02139

Top

Vaccine Design for the FusionNeoAntigens of MVB12B-MED27

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
MVB12B-MED27	chr9	129102909	chr9	134889854	4	14	NRAPTGYDVL	AACCGAGCCCCGACAGGCTATGACGTATTG
MVB12B-MED27	chr9	129102909	chr9	134889854	5	14	RAPTGYDVL	CGAGCCCCGACAGGCTATGACGTATTG
MVB12B-MED27	chr9	129102909	chr9	134889854	6	16	APTGYDVLQY	GCCCCGACAGGCTATGACGTATTGCAGTAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
MVB12B-MED27	chr9	129102909	chr9	134889854	7	22	PTGYDVLQYHAGLAS	CCGACAGGCTATGACGTATTGCAGTACCATGCAGGACTAGCATCT
MVB12B-MED27	chr9	129102909	chr9	134889854	8	23	TGYDVLQYHAGLASG	ACAGGCTATGACGTATTGCAGTACCATGCAGGACTAGCATCTGGC
MVB12B-MED27	chr9	129102909	chr9	134889854	9	24	GYDVLQYHAGLASGL	GGCTATGACGTATTGCAGTACCATGCAGGACTAGCATCTGGCCTT

Top

Information of the samples that have these potential fusion neoantigens of MVB12B-MED27

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SKCM	MVB12B-MED27	chr9	129102909	ENST00000361171	chr9	134889854	ENST00000292035	TCGA-EB-A24D-01A

Top

Potential target of CAR-T therapy development for MVB12B-MED27

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to MVB12B-MED27

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to MVB12B-MED27

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)