![]() |
|||||||
|
Fusion Protein:MYSM1-MIS18A |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MYSM1-MIS18A | FusionPDB ID: 56863 | FusionGDB2.0 ID: 56863 | Hgene | Tgene | Gene symbol | MYSM1 | MIS18A | Gene ID | 114803 | 54069 |
Gene name | Myb like, SWIRM and MPN domains 1 | MIS18 kinetochore protein A | |
Synonyms | 2A-DUB|2ADUB|BMFS4 | B28|C21orf45|C21orf46|FASP1|MIS18alpha|hMis18alpha | |
Cytomap | 1p32.1 | 21q22.11 | |
Type of gene | protein-coding | protein-coding | |
Description | histone H2A deubiquitinase MYSM1myb-like, SWIRM and MPN domain-containing protein 1 | protein Mis18-alphaFAPP1-associated protein 1MIS18 kinetochore protein homolog A | |
Modification date | 20200320 | 20200313 | |
UniProtAcc | Q5VVJ2 Main function of 5'-partner protein: FUNCTION: Metalloprotease with deubiquitinase activity that plays important regulator roles in hematopoietic stem cell function, blood cell production and immune response (PubMed:24062447, PubMed:26220525, PubMed:28115216). Participates in the normal programming of B-cell responses to antigen after the maturation process (By similarity). Within the cytoplasm, plays critical roles in the repression of innate immunity and autoimmunity (PubMed:33086059). Removes 'Lys-63'-linked polyubiquitins from TRAF3 and TRAF6 complexes (By similarity). Attenuates NOD2-mediated inflammation and tissue injury by promoting 'Lys-63'-linked deubiquitination of RIPK2 component (By similarity). Suppresses the CGAS-STING1 signaling pathway by cleaving STING1 'Lys-63'-linked ubiquitin chains (PubMed:33086059). In the nucleus, acts as a hematopoietic transcription regulator derepressing a range of genes essential for normal stem cell differentiation including EBF1 and PAX5 in B-cells, ID2 in NK-cell progenitor or FLT3 in dendritic cell precursors (PubMed:24062447). Deubiquitinates monoubiquitinated histone H2A, a specific tag for epigenetic transcriptional repression, leading to dissociation of histone H1 from the nucleosome (PubMed:17707232). {ECO:0000250|UniProtKB:Q69Z66, ECO:0000269|PubMed:17707232, ECO:0000269|PubMed:22169041, ECO:0000269|PubMed:24062447, ECO:0000269|PubMed:26220525, ECO:0000269|PubMed:28115216, ECO:0000269|PubMed:33086059}. | Q9NYP9 Main function of 5'-partner protein: FUNCTION: Required for recruitment of CENPA to centromeres and normal chromosome segregation during mitosis. {ECO:0000269|PubMed:17199038}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000472487, ENST00000493821, | ENST00000486363, ENST00000290130, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 9 X 11 X 6=594 | 4 X 3 X 3=36 |
# samples | 11 | 4 | |
** MAII score | log2(11/594*10)=-2.43295940727611 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/36*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: MYSM1 [Title/Abstract] AND MIS18A [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MYSM1 [Title/Abstract] AND MIS18A [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MYSM1(59155897)-MIS18A(33642840), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | MYSM1-MIS18A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MYSM1-MIS18A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:59155897/chr21:33642840) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000472487 | MYSM1 | chr1 | 59155897 | - | ENST00000290130 | MIS18A | chr21 | 33642840 | - | 1479 | 360 | 40 | 660 | 206 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000472487 | ENST00000290130 | MYSM1 | chr1 | 59155897 | - | MIS18A | chr21 | 33642840 | - | 0.00138256 | 0.9986174 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MYSM1-MIS18A |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MYSM1 | chr1 | 59155897 | MIS18A | chr21 | 33642840 | 360 | 107 | KYMKSLQKTAKIIVLETLCCAGCSLN |
Top |
Potential FusionNeoAntigen Information of MYSM1-MIS18A in HLA I |
![]() |
MYSM1-MIS18A_59155897_33642840.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:24 | AKIIVLETL | 0.9975 | 0.7317 | 9 | 18 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:01 | QKTAKIIVL | 0.9974 | 0.7657 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B14:01 | QKTAKIIVL | 0.9948 | 0.5265 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B14:02 | QKTAKIIVL | 0.9948 | 0.5265 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:13 | QKTAKIIVL | 0.9932 | 0.8076 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:13 | AKIIVLETL | 0.98 | 0.9812 | 9 | 18 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B13:02 | LQKTAKIIV | 0.4582 | 0.6518 | 5 | 14 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B52:01 | LQKTAKIIV | 0.0345 | 0.8675 | 5 | 14 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B57:03 | KTAKIIVLETL | 0.9993 | 0.992 | 7 | 18 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-C15:06 | KTAKIIVL | 0.9999 | 0.8616 | 7 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:09 | QKTAKIIVL | 0.9982 | 0.5287 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:09 | AKIIVLETL | 0.9969 | 0.8335 | 9 | 18 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:12 | QKTAKIIVL | 0.9968 | 0.7695 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:05 | QKTAKIIVL | 0.9919 | 0.7423 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B15:04 | LQKTAKIIV | 0.8148 | 0.8638 | 5 | 14 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B14:03 | QKTAKIIVL | 0.6362 | 0.5979 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B15:04 | LQKTAKIIVL | 0.9791 | 0.8651 | 5 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-C15:02 | KTAKIIVL | 0.9999 | 0.8073 | 7 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-C15:05 | KTAKIIVL | 0.9999 | 0.8421 | 7 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-C16:02 | KTAKIIVL | 0.9997 | 0.9714 | 7 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:02 | QKTAKIIVL | 0.9975 | 0.8098 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:31 | QKTAKIIVL | 0.9975 | 0.7666 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B39:02 | AKIIVLETL | 0.9969 | 0.9815 | 9 | 18 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B15:09 | QKTAKIIVL | 0.8366 | 0.5828 | 6 | 15 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B48:02 | AKIIVLETL | 0.6227 | 0.8914 | 9 | 18 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | HLA-B15:68 | AKIIVLETL | 0.142 | 0.743 | 9 | 18 |
Top |
Potential FusionNeoAntigen Information of MYSM1-MIS18A in HLA II |
![]() |
MYSM1-MIS18A_59155897_33642840.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1401 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1401 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1426 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1426 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1428 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1435 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1438 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1438 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1454 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1454 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1458 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1458 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1460 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1460 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1471 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1475 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1486 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1486 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1487 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1487 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1488 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1488 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1490 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1490 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1497 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1497 | YMKSLQKTAKIIVLE | 1 | 16 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1499 | MKSLQKTAKIIVLET | 2 | 17 |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 | DRB1-1499 | YMKSLQKTAKIIVLE | 1 | 16 |
Top |
Fusion breakpoint peptide structures of MYSM1-MIS18A |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7363 | QKTAKIIVLETLCC | MYSM1 | MIS18A | chr1 | 59155897 | chr21 | 33642840 | 360 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MYSM1-MIS18A |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7363 | QKTAKIIVLETLCC | -6.6779 | -6.7897 |
HLA-B14:02 | 3BVN | 7363 | QKTAKIIVLETLCC | -3.28788 | -4.33098 |
HLA-B52:01 | 3W39 | 7363 | QKTAKIIVLETLCC | -7.60207 | -7.71387 |
HLA-B52:01 | 3W39 | 7363 | QKTAKIIVLETLCC | -5.07484 | -6.11794 |
HLA-A24:02 | 5HGA | 7363 | QKTAKIIVLETLCC | -6.91423 | -7.02603 |
HLA-A24:02 | 5HGA | 7363 | QKTAKIIVLETLCC | -4.89502 | -5.93812 |
HLA-B27:05 | 6PYJ | 7363 | QKTAKIIVLETLCC | -4.17707 | -5.22017 |
HLA-B44:05 | 3DX8 | 7363 | QKTAKIIVLETLCC | -6.19701 | -6.30881 |
HLA-B44:05 | 3DX8 | 7363 | QKTAKIIVLETLCC | -5.18733 | -6.23043 |
Top |
Vaccine Design for the FusionNeoAntigens of MYSM1-MIS18A |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 5 | 14 | LQKTAKIIV | TCTGCAGAAAACAGCAAAAATCATCGT |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 5 | 15 | LQKTAKIIVL | TCTGCAGAAAACAGCAAAAATCATCGTCCT |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 6 | 15 | QKTAKIIVL | GCAGAAAACAGCAAAAATCATCGTCCT |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 7 | 15 | KTAKIIVL | GAAAACAGCAAAAATCATCGTCCT |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 7 | 18 | KTAKIIVLETL | GAAAACAGCAAAAATCATCGTCCTTGAGACTTT |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 9 | 18 | AKIIVLETL | AGCAAAAATCATCGTCCTTGAGACTTT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 1 | 16 | YMKSLQKTAKIIVLE | ATACATGAAGAGTCTGCAGAAAACAGCAAAAATCATCGTCCTTGA |
MYSM1-MIS18A | chr1 | 59155897 | chr21 | 33642840 | 2 | 17 | MKSLQKTAKIIVLET | CATGAAGAGTCTGCAGAAAACAGCAAAAATCATCGTCCTTGAGAC |
Top |
Information of the samples that have these potential fusion neoantigens of MYSM1-MIS18A |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | MYSM1-MIS18A | chr1 | 59155897 | ENST00000472487 | chr21 | 33642840 | ENST00000290130 | TCGA-CD-A48C |
Top |
Potential target of CAR-T therapy development for MYSM1-MIS18A |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MYSM1-MIS18A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MYSM1-MIS18A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |