|
|||||||
|
Fusion Protein:NARS-DAXX |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: NARS-DAXX | FusionPDB ID: 57289 | FusionGDB2.0 ID: 57289 | Hgene | Tgene | Gene symbol | NARS | DAXX | Gene ID | 4677 | 1616 |
| Gene name | asparaginyl-tRNA synthetase 1 | death domain associated protein | |
| Synonyms | ASNRS|NARS | BING2|DAP6|EAP1|SMIM40 | |
| Cytomap | 18q21.31 | 6p21.32 | |
| Type of gene | protein-coding | protein-coding | |
| Description | asparagine--tRNA ligase, cytoplasmicasparagine tRNA ligase 1, cytoplasmicasparaginyl-tRNA synthetase, cytoplasmic | death domain-associated protein 6CENP-C binding proteinETS1-associated protein 1Fas-binding proteindeath-associated protein 6fas death domain-associated protein | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q96I59 Main function of 5'-partner protein: | Q9UER7 Main function of 5'-partner protein: FUNCTION: Transcription corepressor known to repress transcriptional potential of several sumoylated transcription factors. Down-regulates basal and activated transcription. Its transcription repressor activity is modulated by recruiting it to subnuclear compartments like the nucleolus or PML/POD/ND10 nuclear bodies through interactions with MCSR1 and PML, respectively. Seems to regulate transcription in PML/POD/ND10 nuclear bodies together with PML and may influence TNFRSF6-dependent apoptosis thereby. Inhibits transcriptional activation of PAX3 and ETS1 through direct protein-protein interactions. Modulates PAX5 activity; the function seems to involve CREBBP. Acts as an adapter protein in a MDM2-DAXX-USP7 complex by regulating the RING-finger E3 ligase MDM2 ubiquitination activity. Under non-stress condition, in association with the deubiquitinating USP7, prevents MDM2 self-ubiquitination and enhances the intrinsic E3 ligase activity of MDM2 towards TP53, thereby promoting TP53 ubiquitination and subsequent proteasomal degradation. Upon DNA damage, its association with MDM2 and USP7 is disrupted, resulting in increased MDM2 autoubiquitination and consequently, MDM2 degradation, which leads to TP53 stabilization. Acts as histone chaperone that facilitates deposition of histone H3.3. Acts as targeting component of the chromatin remodeling complex ATRX:DAXX which has ATP-dependent DNA translocase activity and catalyzes the replication-independent deposition of histone H3.3 in pericentric DNA repeats outside S-phase and telomeres, and the in vitro remodeling of H3.3-containing nucleosomes. Does not affect the ATPase activity of ATRX but alleviates its transcription repression activity. Upon neuronal activation associates with regulatory elements of selected immediate early genes where it promotes deposition of histone H3.3 which may be linked to transcriptional induction of these genes. Required for the recruitment of histone H3.3:H4 dimers to PML-nuclear bodies (PML-NBs); the process is independent of ATRX and facilitated by ASF1A; PML-NBs are suggested to function as regulatory sites for the incorporation of newly synthesized histone H3.3 into chromatin. In case of overexpression of centromeric histone variant CENPA (as found in various tumors) is involved in its mislocalization to chromosomes; the ectopic localization involves a heterotypic tetramer containing CENPA, and histones H3.3 and H4 and decreases binding of CTCF to chromatin. Proposed to mediate activation of the JNK pathway and apoptosis via MAP3K5 in response to signaling from TNFRSF6 and TGFBR2. Interaction with HSPB1/HSP27 may prevent interaction with TNFRSF6 and MAP3K5 and block DAXX-mediated apoptosis. In contrast, in lymphoid cells JNC activation and TNFRSF6-mediated apoptosis may not involve DAXX. Shows restriction activity towards human cytomegalovirus (HCMV). Plays a role as a positive regulator of the heat shock transcription factor HSF1 activity during the stress protein response (PubMed:15016915). {ECO:0000269|PubMed:12140263, ECO:0000269|PubMed:14990586, ECO:0000269|PubMed:15016915, ECO:0000269|PubMed:15364927, ECO:0000269|PubMed:16845383, ECO:0000269|PubMed:17081986, ECO:0000269|PubMed:17942542, ECO:0000269|PubMed:20504901, ECO:0000269|PubMed:20651253, ECO:0000269|PubMed:23222847, ECO:0000269|PubMed:24200965, ECO:0000269|PubMed:24530302}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000256854, ENST00000423481, | ENST00000477162, ENST00000383062, ENST00000383194, ENST00000399060, ENST00000399344, ENST00000414388, ENST00000433482, ENST00000436311, ENST00000445009, ENST00000455860, ENST00000461796, ENST00000469277, ENST00000472399, ENST00000494562, ENST00000266000, ENST00000374542, ENST00000414083, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 6 X 6 X 2=72 | 7 X 4 X 5=140 |
| # samples | 6 | 7 | |
| ** MAII score | log2(6/72*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/140*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: NARS [Title/Abstract] AND DAXX [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: NARS [Title/Abstract] AND DAXX [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | NARS(55269587)-DAXX(33288237), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | NARS-DAXX seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NARS-DAXX seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NARS-DAXX seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. NARS-DAXX seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. NARS-DAXX seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. NARS-DAXX seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | NARS | GO:0006421 | asparaginyl-tRNA aminoacylation | 9421509 |
| Hgene | NARS | GO:0016477 | cell migration | 9421509 |
| Tgene | DAXX | GO:0006334 | nucleosome assembly | 20504901|20651253 |
| Tgene | DAXX | GO:0006338 | chromatin remodeling | 20651253 |
| Tgene | DAXX | GO:0006355 | regulation of transcription, DNA-templated | 15878163 |
| Tgene | DAXX | GO:0030521 | androgen receptor signaling pathway | 15572661 |
| Tgene | DAXX | GO:0031396 | regulation of protein ubiquitination | 18566590 |
| Tgene | DAXX | GO:0034605 | cellular response to heat | 15016915 |
| Tgene | DAXX | GO:0034620 | cellular response to unfolded protein | 15016915 |
| Tgene | DAXX | GO:0045892 | negative regulation of transcription, DNA-templated | 12140263|15572661 |
| Tgene | DAXX | GO:0071276 | cellular response to cadmium ion | 15016915 |
| Tgene | DAXX | GO:0071280 | cellular response to copper ion | 15016915 |
| Tgene | DAXX | GO:0072738 | cellular response to diamide | 15016915 |
| Tgene | DAXX | GO:1903936 | cellular response to sodium arsenite | 15016915 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr18:55269587/chr6:33288237) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across NARS (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across DAXX (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000423481 | NARS | chr18 | 55269587 | - | ENST00000266000 | DAXX | chr6 | 33288237 | - | 2412 | 1174 | 1572 | 2411 | 280 |
| ENST00000423481 | NARS | chr18 | 55269587 | - | ENST00000374542 | DAXX | chr6 | 33288237 | - | 2412 | 1174 | 1572 | 2411 | 280 |
| ENST00000423481 | NARS | chr18 | 55269587 | - | ENST00000414083 | DAXX | chr6 | 33288237 | - | 2251 | 1174 | 1411 | 2250 | 280 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000423481 | ENST00000266000 | NARS | chr18 | 55269587 | - | DAXX | chr6 | 33288237 | - | 0.005465948 | 0.994534 |
| ENST00000423481 | ENST00000374542 | NARS | chr18 | 55269587 | - | DAXX | chr6 | 33288237 | - | 0.005465948 | 0.994534 |
| ENST00000423481 | ENST00000414083 | NARS | chr18 | 55269587 | - | DAXX | chr6 | 33288237 | - | 0.005833893 | 0.99416614 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for NARS-DAXX |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| NARS | chr18 | 55269587 | DAXX | chr6 | 33288237 | 1174 | 253 | MMKRRTKRKKQQQRKKRRARLQGTSS |
Top |
Potential FusionNeoAntigen Information of NARS-DAXX in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| NARS-DAXX_55269587_33288237.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 1174 | HLA-B27:05 | KRKKQQQRK | 0.9938 | 0.8766 | 6 | 15 |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 1174 | HLA-B14:02 | QRKKRRARL | 0.93 | 0.6692 | 12 | 21 |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 1174 | HLA-B14:01 | QRKKRRARL | 0.93 | 0.6692 | 12 | 21 |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 1174 | HLA-B27:14 | KRKKQQQRK | 0.9923 | 0.7736 | 6 | 15 |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 1174 | HLA-B27:10 | KRKKQQQRK | 0.9897 | 0.843 | 6 | 15 |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 1174 | HLA-A30:01 | RTKRKKQQQRK | 0.9951 | 0.7371 | 4 | 15 |
Top |
Potential FusionNeoAntigen Information of NARS-DAXX in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of NARS-DAXX |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 4561 | KRKKQQQRKKRRAR | NARS | DAXX | chr18 | 55269587 | chr6 | 33288237 | 1174 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NARS-DAXX |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 4561 | KRKKQQQRKKRRAR | -6.69561 | -6.80901 |
| HLA-B14:02 | 3BVN | 4561 | KRKKQQQRKKRRAR | -4.57314 | -5.60844 |
| HLA-B52:01 | 3W39 | 4561 | KRKKQQQRKKRRAR | -8.26982 | -8.38322 |
| HLA-B52:01 | 3W39 | 4561 | KRKKQQQRKKRRAR | -4.20619 | -5.24149 |
| HLA-A11:01 | 4UQ2 | 4561 | KRKKQQQRKKRRAR | -6.38936 | -6.50276 |
| HLA-A11:01 | 4UQ2 | 4561 | KRKKQQQRKKRRAR | -5.4102 | -6.4455 |
| HLA-A24:02 | 5HGA | 4561 | KRKKQQQRKKRRAR | -7.10684 | -7.22024 |
| HLA-A24:02 | 5HGA | 4561 | KRKKQQQRKKRRAR | -5.37582 | -6.41112 |
| HLA-B44:05 | 3DX8 | 4561 | KRKKQQQRKKRRAR | -5.61918 | -5.73258 |
| HLA-B44:05 | 3DX8 | 4561 | KRKKQQQRKKRRAR | -4.56468 | -5.59998 |
Top |
Vaccine Design for the FusionNeoAntigens of NARS-DAXX |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 12 | 21 | QRKKRRARL | CAGACAAGTGTGGCCACACAATGCGAT |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 4 | 15 | RTKRKKQQQRK | ACTCCCTATTACTGGTATACGGATCAGACAAGT |
| NARS-DAXX | chr18 | 55269587 | chr6 | 33288237 | 6 | 15 | KRKKQQQRK | TATTACTGGTATACGGATCAGACAAGT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of NARS-DAXX |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | NARS-DAXX | chr18 | 55269587 | ENST00000423481 | chr6 | 33288237 | ENST00000266000 | TCGA-BR-A4PD-01A |
Top |
Potential target of CAR-T therapy development for NARS-DAXX |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to NARS-DAXX |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to NARS-DAXX |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies