![]() |
|||||||
|
Fusion Protein:NCOA2-ZNF277 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: NCOA2-ZNF277 | FusionPDB ID: 57728 | FusionGDB2.0 ID: 57728 | Hgene | Tgene | Gene symbol | NCOA2 | ZNF277 | Gene ID | 10499 | 11179 |
Gene name | nuclear receptor coactivator 2 | zinc finger protein 277 | |
Synonyms | GRIP1|KAT13C|NCoA-2|SRC2|TIF2|bHLHe75 | NRIF4|ZNF277P | |
Cytomap | 8q13.3 | 7q31.1 | |
Type of gene | protein-coding | protein-coding | |
Description | nuclear receptor coactivator 2class E basic helix-loop-helix protein 75glucocorticoid receptor-interacting protein-1p160 steroid receptor coactivator 2transcriptional intermediary factor 2 | zinc finger protein 277nuclear receptor-interacting factor 4zinc finger protein (C2H2 type) 277zinc finger protein 277 pseudogene | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q15596 Main function of 5'-partner protein: FUNCTION: Transcriptional coactivator for steroid receptors and nuclear receptors. Coactivator of the steroid binding domain (AF-2) but not of the modulating N-terminal domain (AF-1). Required with NCOA1 to control energy balance between white and brown adipose tissues. Critical regulator of glucose metabolism regulation, acts as RORA coactivator to specifically modulate G6PC1 expression. Involved in the positive regulation of the transcriptional activity of the glucocorticoid receptor NR3C1 by sumoylation enhancer RWDD3. Positively regulates the circadian clock by acting as a transcriptional coactivator for the CLOCK-ARNTL/BMAL1 heterodimer (By similarity). {ECO:0000250|UniProtKB:Q61026, ECO:0000269|PubMed:23508108, ECO:0000269|PubMed:9430642}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000452400, ENST00000267974, ENST00000524223, | ENST00000421043, ENST00000361822, ENST00000450657, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 29 X 17 X 12=5916 | 6 X 4 X 4=96 |
# samples | 31 | 6 | |
** MAII score | log2(31/5916*10)=-4.25428193182483 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(6/96*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: NCOA2 [Title/Abstract] AND ZNF277 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: NCOA2 [Title/Abstract] AND ZNF277 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | NCOA2(71126137)-ZNF277(111967771), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | NCOA2-ZNF277 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NCOA2-ZNF277 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NCOA2-ZNF277 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NCOA2-ZNF277 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:71126137/chr7:111967771) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000452400 | NCOA2 | chr8 | 71126137 | - | ENST00000361822 | ZNF277 | chr7 | 111967771 | + | 1604 | 441 | 388 | 1236 | 282 |
ENST00000452400 | NCOA2 | chr8 | 71126137 | - | ENST00000450657 | ZNF277 | chr7 | 111967771 | + | 943 | 441 | 388 | 756 | 122 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000452400 | ENST00000361822 | NCOA2 | chr8 | 71126137 | - | ZNF277 | chr7 | 111967771 | + | 0.004439312 | 0.99556065 |
ENST00000452400 | ENST00000450657 | NCOA2 | chr8 | 71126137 | - | ZNF277 | chr7 | 111967771 | + | 0.040933385 | 0.9590667 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for NCOA2-ZNF277 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
NCOA2 | chr8 | 71126137 | ZNF277 | chr7 | 111967771 | 441 | 17 | KRNCEANSSDQRTRSVILNHMAREHA |
Top |
Potential FusionNeoAntigen Information of NCOA2-ZNF277 in HLA I |
![]() |
NCOA2-ZNF277_71126137_111967771.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:02 | TRSVILNHM | 0.9997 | 0.7252 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:04 | TRSVILNHM | 0.9997 | 0.7619 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:05 | TRSVILNHM | 0.9996 | 0.9378 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B38:02 | TRSVILNHM | 0.9941 | 0.9306 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-A30:08 | RTRSVILNH | 0.9888 | 0.5625 | 11 | 20 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B15:18 | TRSVILNHM | 0.6561 | 0.635 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-A30:08 | RTRSVILNHM | 0.9906 | 0.5456 | 11 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-A30:08 | RTRSVILNHMA | 0.9937 | 0.6567 | 11 | 22 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C04:07 | SSDQRTRSV | 0.9999 | 0.8926 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C05:09 | SSDQRTRSV | 0.9999 | 0.9409 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C04:10 | SSDQRTRSV | 0.9999 | 0.8957 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C08:15 | SSDQRTRSV | 0.9998 | 0.9527 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C01:17 | SSDQRTRSV | 0.9997 | 0.8929 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:14 | TRSVILNHM | 0.9996 | 0.8531 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:95 | TRSVILNHM | 0.9995 | 0.6199 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:05 | TRSVILNHM | 0.9993 | 0.9414 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C15:06 | SSDQRTRSV | 0.9991 | 0.7891 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:29 | TRSVILNHM | 0.9987 | 0.9363 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:27 | TRSVILNHM | 0.9987 | 0.9385 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C03:07 | SSDQRTRSV | 0.9986 | 0.9382 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:13 | TRSVILNHM | 0.9985 | 0.8541 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C04:06 | SSDQRTRSV | 0.9981 | 0.8538 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C15:04 | SSDQRTRSV | 0.998 | 0.7643 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B39:12 | TRSVILNHM | 0.9978 | 0.8576 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C01:30 | SSDQRTRSV | 0.9974 | 0.912 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:03 | TRSVILNHM | 0.9905 | 0.9505 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C04:14 | SSDQRTRSV | 0.9878 | 0.8906 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C08:04 | SSDQRTRSV | 0.9839 | 0.9151 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C08:13 | SSDQRTRSV | 0.9839 | 0.9151 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C03:19 | SSDQRTRSV | 0.9458 | 0.8926 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B14:03 | SSDQRTRSV | 0.9439 | 0.6738 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B39:12 | DQRTRSVIL | 0.9255 | 0.5725 | 9 | 18 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B73:01 | TRSVILNHM | 0.9063 | 0.5016 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C02:06 | SSDQRTRSV | 0.8842 | 0.9034 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:46 | TRSVILNHM | 0.8764 | 0.7391 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C08:03 | SSDQRTRSV | 0.8361 | 0.9402 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:19 | TRSVILNHM | 0.8343 | 0.5389 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:67 | TRSVILNHM | 0.8321 | 0.8773 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:80 | TRSVILNHM | 0.8321 | 0.8773 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C03:08 | SSDQRTRSV | 0.8172 | 0.7568 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:10 | TRSVILNHM | 0.8104 | 0.9062 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C12:04 | SSDQRTRSV | 0.7715 | 0.9804 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C06:03 | SSDQRTRSV | 0.7668 | 0.9733 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C12:12 | SSDQRTRSV | 0.5671 | 0.7968 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B15:04 | RTRSVILNH | 0.4023 | 0.8228 | 11 | 20 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C12:16 | TRSVILNHM | 0.0784 | 0.9391 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B73:01 | TRSVILNHMA | 0.9826 | 0.5359 | 12 | 22 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C04:03 | SSDQRTRSV | 1 | 0.9132 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C05:01 | SSDQRTRSV | 0.9999 | 0.9409 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C04:01 | SSDQRTRSV | 0.9999 | 0.8926 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C18:01 | SSDQRTRSV | 0.9999 | 0.8912 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C01:03 | SSDQRTRSV | 0.9998 | 0.8531 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C08:02 | SSDQRTRSV | 0.9998 | 0.9527 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C01:02 | SSDQRTRSV | 0.9997 | 0.8869 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:10 | TRSVILNHM | 0.9997 | 0.8972 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:08 | TRSVILNHM | 0.9996 | 0.8637 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:06 | TRSVILNHM | 0.9996 | 0.7466 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:01 | TRSVILNHM | 0.9995 | 0.5744 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C15:02 | SSDQRTRSV | 0.9993 | 0.7482 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C15:05 | SSDQRTRSV | 0.9993 | 0.8267 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B27:09 | TRSVILNHM | 0.999 | 0.9065 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C15:09 | SSDQRTRSV | 0.998 | 0.7643 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:17 | TRSVILNHM | 0.9979 | 0.9473 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B39:31 | TRSVILNHM | 0.9978 | 0.8502 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C06:06 | SSDQRTRSV | 0.9966 | 0.9763 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C06:08 | TRSVILNHM | 0.9937 | 0.9875 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-A30:01 | RTRSVILNH | 0.9919 | 0.7412 | 11 | 20 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C03:17 | SSDQRTRSV | 0.9892 | 0.8821 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C03:05 | SSDQRTRSV | 0.9734 | 0.769 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C03:06 | SSDQRTRSV | 0.9705 | 0.9185 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C16:02 | SSDQRTRSV | 0.9555 | 0.9823 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:22 | TRSVILNHM | 0.8687 | 0.6452 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C03:03 | SSDQRTRSV | 0.8669 | 0.9381 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C03:04 | SSDQRTRSV | 0.8669 | 0.9381 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C08:01 | SSDQRTRSV | 0.8361 | 0.9402 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:02 | TRSVILNHM | 0.8321 | 0.8773 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C17:01 | SSDQRTRSV | 0.8172 | 0.8333 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C16:04 | SSDQRTRSV | 0.8067 | 0.9073 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C16:01 | SSDQRTRSV | 0.7961 | 0.9433 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C07:04 | SSDQRTRSV | 0.7729 | 0.888 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C12:03 | SSDQRTRSV | 0.5423 | 0.929 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C06:06 | TRSVILNHM | 0.3595 | 0.9872 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-B07:13 | SSDQRTRSV | 0.1834 | 0.7012 | 7 | 16 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C06:02 | TRSVILNHM | 0.0881 | 0.9904 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-C06:17 | TRSVILNHM | 0.0881 | 0.9904 | 12 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-A30:01 | RTRSVILNHM | 0.9921 | 0.7561 | 11 | 21 |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 | HLA-A30:01 | RTRSVILNHMA | 0.9948 | 0.8464 | 11 | 22 |
Top |
Potential FusionNeoAntigen Information of NCOA2-ZNF277 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of NCOA2-ZNF277 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6397 | NSSDQRTRSVILNH | NCOA2 | ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 441 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NCOA2-ZNF277 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6397 | NSSDQRTRSVILNH | -8.62545 | -8.73885 |
HLA-B14:02 | 3BVN | 6397 | NSSDQRTRSVILNH | -3.26321 | -4.29851 |
HLA-B52:01 | 3W39 | 6397 | NSSDQRTRSVILNH | -6.23413 | -6.34753 |
HLA-B52:01 | 3W39 | 6397 | NSSDQRTRSVILNH | -4.55402 | -5.58932 |
HLA-A24:02 | 5HGA | 6397 | NSSDQRTRSVILNH | -8.62578 | -8.73918 |
HLA-A24:02 | 5HGA | 6397 | NSSDQRTRSVILNH | -6.438 | -7.4733 |
HLA-B44:05 | 3DX8 | 6397 | NSSDQRTRSVILNH | -5.68484 | -5.79824 |
HLA-B44:05 | 3DX8 | 6397 | NSSDQRTRSVILNH | -3.64855 | -4.68385 |
HLA-A02:01 | 6TDR | 6397 | NSSDQRTRSVILNH | -5.14764 | -6.18294 |
Top |
Vaccine Design for the FusionNeoAntigens of NCOA2-ZNF277 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 11 | 20 | RTRSVILNH | AACAAGATCTGTTATTTTGAACCACAT |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 11 | 21 | RTRSVILNHM | AACAAGATCTGTTATTTTGAACCACATGGC |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 11 | 22 | RTRSVILNHMA | AACAAGATCTGTTATTTTGAACCACATGGCCAG |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 12 | 21 | TRSVILNHM | AAGATCTGTTATTTTGAACCACATGGC |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 12 | 22 | TRSVILNHMA | AAGATCTGTTATTTTGAACCACATGGCCAG |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 7 | 16 | SSDQRTRSV | GTCAGATCAAAGAACAAGATCTGTTAT |
NCOA2-ZNF277 | chr8 | 71126137 | chr7 | 111967771 | 9 | 18 | DQRTRSVIL | TCAAAGAACAAGATCTGTTATTTTGAA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of NCOA2-ZNF277 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BLCA | NCOA2-ZNF277 | chr8 | 71126137 | ENST00000452400 | chr7 | 111967771 | ENST00000361822 | TCGA-FD-A3SP |
Top |
Potential target of CAR-T therapy development for NCOA2-ZNF277 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to NCOA2-ZNF277 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to NCOA2-ZNF277 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | NCOA2 | C0006142 | Malignant neoplasm of breast | 1 | CTD_human |
Hgene | NCOA2 | C0033578 | Prostatic Neoplasms | 1 | CTD_human |
Hgene | NCOA2 | C0376358 | Malignant neoplasm of prostate | 1 | CTD_human |
Hgene | NCOA2 | C0678222 | Breast Carcinoma | 1 | CTD_human |
Hgene | NCOA2 | C1257931 | Mammary Neoplasms, Human | 1 | CTD_human |
Hgene | NCOA2 | C1458155 | Mammary Neoplasms | 1 | CTD_human |
Hgene | NCOA2 | C4704874 | Mammary Carcinoma, Human | 1 | CTD_human |