Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NEK7-SMYD3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NEK7-SMYD3
	FusionPDB ID: 58545
	FusionGDB2.0 ID: 58545
		Hgene	Tgene
	Gene symbol	NEK7	SMYD3
	Gene ID	140609	64754
	Gene name	NIMA related kinase 7	SET and MYND domain containing 3
	Synonyms	-	KMT3E\|ZMYND1\|ZNFN3A1\|bA74P14.1
	Cytomap	1q31.3	1q44
	Type of gene	protein-coding	protein-coding
	Description	serine/threonine-protein kinase Nek7NIMA (never in mitosis gene a)-related kinase 7never in mitosis A-related kinase 7nimA-related protein kinase 7	histone-lysine N-methyltransferase SMYD3SET and MYND domain-containing protein 3bA74P14.1 (novel protein)zinc finger MYND domain-containing protein 1zinc finger protein, subfamily 3A (MYND domain containing), 1zinc finger, MYND domain containing 1
	Modification date	20200313	20200320
	UniProtAcc	Q8TDX7 Main function of 5'-partner protein: FUNCTION: Protein kinase which plays an important role in mitotic cell cycle progression (PubMed:17101132). Required for microtubule nucleation activity of the centrosome, robust mitotic spindle formation and cytokinesis (PubMed:17586473, PubMed:19414596). Phosphorylates RPS6KB1 (By similarity). Phosphorylates EML4 at 'Ser-146', promoting its dissociation from microtubules during mitosis which is required for efficient chromosome congression (PubMed:31409757). {ECO:0000250\|UniProtKB:D3ZBE5, ECO:0000269\|PubMed:17101132, ECO:0000269\|PubMed:17586473, ECO:0000269\|PubMed:19414596, ECO:0000269\|PubMed:31409757}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000417895, ENST00000367383, ENST00000367385, ENST00000538004,	ENST00000388985, ENST00000490107, ENST00000541742, ENST00000366517, ENST00000403792,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	12 X 5 X 8=480	29 X 14 X 17=6902
	# samples	12	47
	** MAII score	log2(12/480*10)=-2 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(47/6902*10)=-3.87628181187052 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NEK7 [Title/Abstract] AND SMYD3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NEK7 [Title/Abstract] AND SMYD3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NEK7(198201767)-SMYD3(246093239), # samples:3
Anticipated loss of major functional domain due to fusion event.	NEK7-SMYD3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NEK7-SMYD3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NEK7-SMYD3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NEK7-SMYD3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NEK7	GO:0006468	protein phosphorylation	12840024

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:198201767/chr1:246093239)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NEK7 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SMYD3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000367385	NEK7	chr1	198201767	+	ENST00000541742	SMYD3	chr1	246093239	-	1378	399	327	1154	275
ENST00000367385	NEK7	chr1	198201767	+	ENST00000490107	SMYD3	chr1	246093239	-	1376	399	327	1154	275
ENST00000367385	NEK7	chr1	198201767	+	ENST00000388985	SMYD3	chr1	246093239	-	1155	399	327	1154	275
ENST00000538004	NEK7	chr1	198201767	+	ENST00000541742	SMYD3	chr1	246093239	-	1163	184	112	939	275
ENST00000538004	NEK7	chr1	198201767	+	ENST00000490107	SMYD3	chr1	246093239	-	1161	184	112	939	275
ENST00000538004	NEK7	chr1	198201767	+	ENST00000388985	SMYD3	chr1	246093239	-	940	184	112	939	276
ENST00000367383	NEK7	chr1	198201767	+	ENST00000541742	SMYD3	chr1	246093239	-	1220	241	169	996	275
ENST00000367383	NEK7	chr1	198201767	+	ENST00000490107	SMYD3	chr1	246093239	-	1218	241	169	996	275
ENST00000367383	NEK7	chr1	198201767	+	ENST00000388985	SMYD3	chr1	246093239	-	997	241	169	996	276

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000367385	ENST00000541742	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.002729222	0.99727076
ENST00000367385	ENST00000490107	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.002834676	0.99716526
ENST00000367385	ENST00000388985	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.002725225	0.9972748
ENST00000538004	ENST00000541742	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.001922299	0.99807775
ENST00000538004	ENST00000490107	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.002024772	0.9979753
ENST00000538004	ENST00000388985	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.001634079	0.99836594
ENST00000367383	ENST00000541742	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.001974397	0.99802566
ENST00000367383	ENST00000490107	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.00203894	0.99796104
ENST00000367383	ENST00000388985	NEK7	chr1	198201767	+	SMYD3	chr1	246093239	-	0.001770607	0.99822944

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NEK7-SMYD3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NEK7	chr1	198201767	SMYD3	chr1	246093239	184	23	QGMQGPPVPQFQPQVICNSFTICNAE
NEK7	chr1	198201767	SMYD3	chr1	246093239	241	23	QGMQGPPVPQFQPQVICNSFTICNAE
NEK7	chr1	198201767	SMYD3	chr1	246093239	399	23	QGMQGPPVPQFQPQVICNSFTICNAE

Top

Potential FusionNeoAntigen Information of NEK7-SMYD3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NEK7-SMYD3_198201767_246093239.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:01	VPQFQPQV	0.9933	0.793	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B52:01	PQFQPQVI	0.9315	0.8967	8	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:02	VPQFQPQV	0.9186	0.7028	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:01	QPQVICNSF	0.964	0.7511	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:08	QPQVICNSF	0.9476	0.7209	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:03	VPQFQPQVI	0.8488	0.7492	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:02	VPQFQPQVI	0.8263	0.9137	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:04	VPQFQPQVI	0.8263	0.9137	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:04	QPQVICNSF	0.4386	0.7575	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:02	QPQVICNSF	0.4386	0.7575	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B81:01	VPQFQPQVI	0.2554	0.5912	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B08:09	VPQFQPQVI	0.1947	0.7721	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B78:01	VPQFQPQV	0.9866	0.9216	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:08	VPQFQPQV	0.9519	0.6334	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:07	VPQFQPQVI	0.9821	0.7896	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B78:01	VPQFQPQVI	0.982	0.6395	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:08	VPQFQPQVI	0.9029	0.5352	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:12	VPQFQPQVI	0.8263	0.9137	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B07:12	VPQFQPQVI	0.7654	0.5718	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B07:04	VPQFQPQVI	0.6497	0.5554	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:12	QPQVICNSF	0.4386	0.7575	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B42:02	VPQFQPQVI	0.3594	0.7566	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B42:01	VPQFQPQVI	0.3087	0.7445	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B39:10	QPQVICNSF	0.1911	0.7246	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B39:10	VPQFQPQVI	0.1576	0.9208	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B78:02	VPQFQPQV	0.9932	0.9468	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:13	VPQFQPQV	0.9926	0.7323	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:14	VPQFQPQV	0.9912	0.7399	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:21	VPQFQPQV	0.978	0.8222	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:29	VPQFQPQV	0.956	0.6003	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B51:09	VPQFQPQV	0.9335	0.7549	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B59:01	VPQFQPQV	0.4197	0.7492	7	15
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B78:02	VPQFQPQVI	0.9869	0.7517	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:77	QPQVICNSF	0.964	0.7511	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:23	QPQVICNSF	0.9639	0.7023	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:22	VPQFQPQVI	0.9532	0.5238	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:11	QPQVICNSF	0.9318	0.7546	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:17	QPQVICNSF	0.9193	0.6077	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:30	QPQVICNSF	0.9193	0.6077	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:24	QPQVICNSF	0.893	0.7002	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:13	VPQFQPQVI	0.8491	0.7579	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:09	VPQFQPQVI	0.8263	0.9137	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B55:04	VPQFQPQVI	0.515	0.5631	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B15:08	QPQVICNSF	0.4469	0.6747	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:09	QPQVICNSF	0.4386	0.7575	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B35:43	QPQVICNSF	0.4266	0.6714	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B15:11	QPQVICNSF	0.4148	0.6726	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B18:07	QPQVICNSF	0.2713	0.5944	11	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B67:01	VPQFQPQVI	0.1986	0.9188	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B08:12	VPQFQPQVI	0.1635	0.8626	7	16
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B15:27	FQPQVICNSF	0.9996	0.7788	10	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B15:24	FQPQVICNSF	0.9994	0.7259	10	20
NEK7-SMYD3	chr1	198201767	chr1	246093239	241	HLA-B15:12	FQPQVICNSF	0.9958	0.7611	10	20

Top

Potential FusionNeoAntigen Information of NEK7-SMYD3 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NEK7-SMYD3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7085	PVPQFQPQVICNSF	NEK7	SMYD3	chr1	198201767	chr1	246093239	241

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NEK7-SMYD3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7085	PVPQFQPQVICNSF	-4.62424	-5.65954
HLA-B14:02	3BVN	7085	PVPQFQPQVICNSF	-4.1114	-4.2248
HLA-B52:01	3W39	7085	PVPQFQPQVICNSF	-6.8001	-6.9135
HLA-B52:01	3W39	7085	PVPQFQPQVICNSF	-6.46104	-7.49634
HLA-A24:02	5HGA	7085	PVPQFQPQVICNSF	-9.1447	-9.2581
HLA-A24:02	5HGA	7085	PVPQFQPQVICNSF	-6.01279	-7.04809
HLA-B44:05	3DX8	7085	PVPQFQPQVICNSF	-5.02862	-5.14202
HLA-B44:05	3DX8	7085	PVPQFQPQVICNSF	-4.60714	-5.64244

Top

Vaccine Design for the FusionNeoAntigens of NEK7-SMYD3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NEK7-SMYD3	chr1	198201767	chr1	246093239	10	20	FQPQVICNSF	CAACCACAGGTGATCTGCAACTCTTTCACC
NEK7-SMYD3	chr1	198201767	chr1	246093239	11	20	QPQVICNSF	CCACAGGTGATCTGCAACTCTTTCACC
NEK7-SMYD3	chr1	198201767	chr1	246093239	7	15	VPQFQPQV	CCTCAGTTCCAACCACAGGTGATC
NEK7-SMYD3	chr1	198201767	chr1	246093239	7	16	VPQFQPQVI	CCTCAGTTCCAACCACAGGTGATCTGC
NEK7-SMYD3	chr1	198201767	chr1	246093239	8	16	PQFQPQVI	CAGTTCCAACCACAGGTGATCTGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NEK7-SMYD3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	NEK7-SMYD3	chr1	198201767	ENST00000367383	chr1	246093239	ENST00000388985	TCGA-QQ-A5VC-01A

Top

Potential target of CAR-T therapy development for NEK7-SMYD3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NEK7-SMYD3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NEK7-SMYD3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)