Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NFASC-ATP2B4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NFASC-ATP2B4
	FusionPDB ID: 58738
	FusionGDB2.0 ID: 58738
		Hgene	Tgene
	Gene symbol	NFASC	ATP2B4
	Gene ID	23114	493
	Gene name	neurofascin	ATPase plasma membrane Ca2+ transporting 4
	Synonyms	NEDCPMD\|NF\|NRCAML	ATP2B2\|MXRA1\|PMCA4\|PMCA4b\|PMCA4x
	Cytomap	1q32.1	1q32.1
	Type of gene	protein-coding	protein-coding
	Description	neurofascinneurofascin homologneurofascin isoform 140	plasma membrane calcium-transporting ATPase 4ATPase, Ca++ transporting, plasma membrane 4matrix-remodeling-associated protein 1sarcolemmal calcium pump
	Modification date	20200313	20200327
	UniProtAcc	O94856 Main function of 5'-partner protein: FUNCTION: Cell adhesion, ankyrin-binding protein which may be involved in neurite extension, axonal guidance, synaptogenesis, myelination and neuron-glial cell interactions. {ECO:0000250}.	P23634 Main function of 5'-partner protein: FUNCTION: Calcium/calmodulin-regulated and magnesium-dependent enzyme that catalyzes the hydrolysis of ATP coupled with the transport of calcium out of the cell (PubMed:8530416). By regulating sperm cell calcium homeostasis, may play a role in sperm motility (By similarity). {ECO:0000250\|UniProtKB:Q6Q477, ECO:0000269\|PubMed:8530416}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000495396, ENST00000338515, ENST00000338586, ENST00000339876, ENST00000360049, ENST00000367169, ENST00000367170, ENST00000367171, ENST00000367172, ENST00000401399, ENST00000404076, ENST00000404907, ENST00000513543, ENST00000539706, ENST00000403080,	ENST00000341360, ENST00000357681, ENST00000367218, ENST00000367219, ENST00000391954, ENST00000466407,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	16 X 10 X 4=640	13 X 15 X 8=1560
	# samples	21	16
	** MAII score	log2(21/640*10)=-1.60768257722124 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(16/1560*10)=-3.28540221886225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NFASC [Title/Abstract] AND ATP2B4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NFASC [Title/Abstract] AND ATP2B4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NFASC(204797910)-ATP2B4(203667285), # samples:2 ATP2B4(203596347)-NFASC(204889760), # samples:2
Anticipated loss of major functional domain due to fusion event.	NFASC-ATP2B4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFASC-ATP2B4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFASC-ATP2B4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NFASC-ATP2B4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NFASC-ATP2B4 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. NFASC-ATP2B4 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ATP2B4	GO:0006874	cellular calcium ion homeostasis	19278978\|25798335
Tgene	ATP2B4	GO:0010629	negative regulation of gene expression	25147342
Tgene	ATP2B4	GO:0010751	negative regulation of nitric oxide mediated signal transduction	19278978
Tgene	ATP2B4	GO:0016525	negative regulation of angiogenesis	25147342
Tgene	ATP2B4	GO:0033138	positive regulation of peptidyl-serine phosphorylation	19278978
Tgene	ATP2B4	GO:0043537	negative regulation of blood vessel endothelial cell migration	25147342
Tgene	ATP2B4	GO:0045019	negative regulation of nitric oxide biosynthetic process	11591728\|19278978
Tgene	ATP2B4	GO:0051001	negative regulation of nitric-oxide synthase activity	11591728\|17242280\|19278978\|19287093
Tgene	ATP2B4	GO:0070885	negative regulation of calcineurin-NFAT signaling cascade	19287093\|25147342
Tgene	ATP2B4	GO:0071872	cellular response to epinephrine stimulus	19278978
Tgene	ATP2B4	GO:0098736	negative regulation of the force of heart contraction	17242280
Tgene	ATP2B4	GO:0140199	negative regulation of adenylate cyclase-activating adrenergic receptor signaling pathway involved in heart process	17242280
Tgene	ATP2B4	GO:1900082	negative regulation of arginine catabolic process	19278978
Tgene	ATP2B4	GO:1901660	calcium ion export	25798335
Tgene	ATP2B4	GO:1902548	negative regulation of cellular response to vascular endothelial growth factor stimulus	25147342
Tgene	ATP2B4	GO:1903078	positive regulation of protein localization to plasma membrane	15955804
Tgene	ATP2B4	GO:1903249	negative regulation of citrulline biosynthetic process	19278978
Tgene	ATP2B4	GO:2000481	positive regulation of cAMP-dependent protein kinase activity	19278978

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:204797910/chr1:203667285)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NFASC (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ATP2B4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000338586	NFASC	chr1	204957934	+	ENST00000391954	ATP2B4	chr1	203708674	+	7950	3416	7	3441	1144
ENST00000338586	NFASC	chr1	204957934	+	ENST00000367218	ATP2B4	chr1	203708674	+	7950	3416	7	3441	1144
ENST00000338586	NFASC	chr1	204957934	+	ENST00000367219	ATP2B4	chr1	203708674	+	7950	3416	7	3441	1144
ENST00000338515	NFASC	chr1	204957934	+	ENST00000341360	ATP2B4	chr1	203708674	+	4194	3420	7	3504	1165
ENST00000367171	NFASC	chr1	204957934	+	ENST00000341360	ATP2B4	chr1	203708674	+	4011	3237	7	3321	1104
ENST00000367169	NFASC	chr1	204957934	+	ENST00000341360	ATP2B4	chr1	203708674	+	3873	3099	7	3183	1058
ENST00000539706	NFASC	chr1	204957934	+	ENST00000391954	ATP2B4	chr1	203708674	+	7938	3404	7	3429	1140
ENST00000539706	NFASC	chr1	204957934	+	ENST00000367218	ATP2B4	chr1	203708674	+	7938	3404	7	3429	1140
ENST00000539706	NFASC	chr1	204957934	+	ENST00000367219	ATP2B4	chr1	203708674	+	7938	3404	7	3429	1140
ENST00000339876	NFASC	chr1	204957934	+	ENST00000391954	ATP2B4	chr1	203708674	+	7629	3095	7	3120	1037
ENST00000339876	NFASC	chr1	204957934	+	ENST00000367218	ATP2B4	chr1	203708674	+	7629	3095	7	3120	1037
ENST00000339876	NFASC	chr1	204957934	+	ENST00000367219	ATP2B4	chr1	203708674	+	7629	3095	7	3120	1037
ENST00000367170	NFASC	chr1	204957934	+	ENST00000341360	ATP2B4	chr1	203708674	+	4194	3420	7	3504	1165
ENST00000360049	NFASC	chr1	204957934	+	ENST00000391954	ATP2B4	chr1	203708674	+	7938	3404	7	3429	1140
ENST00000360049	NFASC	chr1	204957934	+	ENST00000367218	ATP2B4	chr1	203708674	+	7938	3404	7	3429	1140
ENST00000360049	NFASC	chr1	204957934	+	ENST00000367219	ATP2B4	chr1	203708674	+	7938	3404	7	3429	1140
ENST00000367172	NFASC	chr1	204957934	+	ENST00000341360	ATP2B4	chr1	203708674	+	4194	3420	7	3504	1165
ENST00000404076	NFASC	chr1	204957934	+	ENST00000391954	ATP2B4	chr1	203708674	+	7981	3447	224	3472	1082
ENST00000404076	NFASC	chr1	204957934	+	ENST00000367218	ATP2B4	chr1	203708674	+	7981	3447	224	3472	1082
ENST00000404076	NFASC	chr1	204957934	+	ENST00000367219	ATP2B4	chr1	203708674	+	7981	3447	224	3472	1082
ENST00000401399	NFASC	chr1	204957934	+	ENST00000391954	ATP2B4	chr1	203708674	+	7500	2966	1	2991	996
ENST00000401399	NFASC	chr1	204957934	+	ENST00000367218	ATP2B4	chr1	203708674	+	7500	2966	1	2991	996
ENST00000401399	NFASC	chr1	204957934	+	ENST00000367219	ATP2B4	chr1	203708674	+	7500	2966	1	2991	996
ENST00000404907	NFASC	chr1	204957934	+	ENST00000391954	ATP2B4	chr1	203708674	+	7700	3166	0	3191	1063
ENST00000404907	NFASC	chr1	204957934	+	ENST00000367218	ATP2B4	chr1	203708674	+	7700	3166	0	3191	1063
ENST00000404907	NFASC	chr1	204957934	+	ENST00000367219	ATP2B4	chr1	203708674	+	7700	3166	0	3191	1063
ENST00000513543	NFASC	chr1	204957934	+	ENST00000391954	ATP2B4	chr1	203708674	+	7675	3141	32	3166	1044
ENST00000513543	NFASC	chr1	204957934	+	ENST00000367218	ATP2B4	chr1	203708674	+	7675	3141	32	3166	1044
ENST00000513543	NFASC	chr1	204957934	+	ENST00000367219	ATP2B4	chr1	203708674	+	7675	3141	32	3166	1044

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000338586	ENST00000391954	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000160884	0.99983907
ENST00000338586	ENST00000367218	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000160884	0.99983907
ENST00000338586	ENST00000367219	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000160884	0.99983907
ENST00000338515	ENST00000341360	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000937634	0.99906236
ENST00000367171	ENST00000341360	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.001196274	0.99880373
ENST00000367169	ENST00000341360	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.001378938	0.9986211
ENST00000539706	ENST00000391954	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000151455	0.9998485
ENST00000539706	ENST00000367218	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000151455	0.9998485
ENST00000539706	ENST00000367219	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000151455	0.9998485
ENST00000339876	ENST00000391954	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000157755	0.99984217
ENST00000339876	ENST00000367218	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000157755	0.99984217
ENST00000339876	ENST00000367219	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000157755	0.99984217
ENST00000367170	ENST00000341360	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000937634	0.99906236
ENST00000360049	ENST00000391954	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000151455	0.9998485
ENST00000360049	ENST00000367218	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000151455	0.9998485
ENST00000360049	ENST00000367219	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000151455	0.9998485
ENST00000367172	ENST00000341360	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000937634	0.99906236
ENST00000404076	ENST00000391954	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000401423	0.99959856
ENST00000404076	ENST00000367218	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000401423	0.99959856
ENST00000404076	ENST00000367219	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000401423	0.99959856
ENST00000401399	ENST00000391954	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000162759	0.99983716
ENST00000401399	ENST00000367218	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000162759	0.99983716
ENST00000401399	ENST00000367219	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000162759	0.99983716
ENST00000404907	ENST00000391954	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000147137	0.9998529
ENST00000404907	ENST00000367218	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000147137	0.9998529
ENST00000404907	ENST00000367219	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000147137	0.9998529
ENST00000513543	ENST00000391954	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000144347	0.99985564
ENST00000513543	ENST00000367218	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000144347	0.99985564
ENST00000513543	ENST00000367219	NFASC	chr1	204957934	+	ATP2B4	chr1	203708674	+	0.000144347	0.99985564

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NFASC-ATP2B4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NFASC	chr1	204957934	ATP2B4	chr1	203708674	3099	1030	AVTEESPAPPNEGRSKWSKRSIVPST
NFASC	chr1	204957934	ATP2B4	chr1	203708674	3237	1076	CRCMAAAPGVKGPRSKWSKRSIVPST
NFASC	chr1	204957934	ATP2B4	chr1	203708674	3420	1137	AVTEESPAPPNEGRSKWSKRSIVPST

Top

Potential FusionNeoAntigen Information of NFASC-ATP2B4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NFASC-ATP2B4_204957934_203708674.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B57:01	GVKGPRSKW	0.9915	0.9702	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B58:02	GVKGPRSKW	0.9572	0.9341	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-A32:13	GVKGPRSKW	0.5296	0.9532	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B07:02	GPRSKWSKRSI	0.9992	0.5226	11	22
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-A30:08	GVKGPRSKWSK	0.9961	0.8319	8	19
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B57:04	GVKGPRSKW	0.9925	0.8468	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B57:10	GVKGPRSKW	0.9915	0.9702	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B58:06	GVKGPRSKW	0.984	0.882	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-A32:01	GVKGPRSKW	0.9599	0.9489	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B15:13	GVKGPRSKW	0.8179	0.736	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B15:24	GVKGPRSKW	0.7728	0.9477	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-A25:01	GVKGPRSKW	0.2836	0.882	8	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B07:22	GPRSKWSKRSI	0.9992	0.5226	11	22
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-B07:09	APGVKGPRSKW	0.998	0.6555	6	17
NFASC-ATP2B4	chr1	204957934	chr1	203708674	3237	HLA-A30:01	GVKGPRSKWSK	0.9959	0.9344	8	19

Top

Potential FusionNeoAntigen Information of NFASC-ATP2B4 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NFASC-ATP2B4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
483	APGVKGPRSKWSKR	NFASC	ATP2B4	chr1	204957934	chr1	203708674	3237

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NFASC-ATP2B4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	483	APGVKGPRSKWSKR	-7.15543	-7.26883
HLA-B14:02	3BVN	483	APGVKGPRSKWSKR	-4.77435	-5.80965
HLA-B52:01	3W39	483	APGVKGPRSKWSKR	-6.80875	-6.92215
HLA-B52:01	3W39	483	APGVKGPRSKWSKR	-4.20386	-5.23916
HLA-A11:01	4UQ2	483	APGVKGPRSKWSKR	-7.5194	-8.5547
HLA-A11:01	4UQ2	483	APGVKGPRSKWSKR	-6.9601	-7.0735
HLA-A24:02	5HGA	483	APGVKGPRSKWSKR	-7.52403	-7.63743
HLA-A24:02	5HGA	483	APGVKGPRSKWSKR	-5.82433	-6.85963
HLA-B27:05	6PYJ	483	APGVKGPRSKWSKR	-3.28285	-4.31815
HLA-B44:05	3DX8	483	APGVKGPRSKWSKR	-5.91172	-6.94702
HLA-B44:05	3DX8	483	APGVKGPRSKWSKR	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of NFASC-ATP2B4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NFASC-ATP2B4	chr1	204957934	chr1	203708674	11	22	GPRSKWSKRSI	TCCCAGATCAAAGTGGTCAAAGCGTTCCATAGT
NFASC-ATP2B4	chr1	204957934	chr1	203708674	6	17	APGVKGPRSKW	CCCTGGGGTAAAAGGTCCCAGATCAAAGTGGTC
NFASC-ATP2B4	chr1	204957934	chr1	203708674	8	17	GVKGPRSKW	GGTAAAAGGTCCCAGATCAAAGTGGTC
NFASC-ATP2B4	chr1	204957934	chr1	203708674	8	19	GVKGPRSKWSK	GGTAAAAGGTCCCAGATCAAAGTGGTCAAAGCG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NFASC-ATP2B4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LGG	NFASC-ATP2B4	chr1	204957934	ENST00000367171	chr1	203708674	ENST00000341360	TCGA-DU-7292

Top

Potential target of CAR-T therapy development for NFASC-ATP2B4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NFASC-ATP2B4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NFASC-ATP2B4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)