![]() |
|||||||
|
Fusion Protein:ARFGEF2-TBL2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ARFGEF2-TBL2 | FusionPDB ID: 5877 | FusionGDB2.0 ID: 5877 | Hgene | Tgene | Gene symbol | ARFGEF2 | TBL2 | Gene ID | 10564 | 26608 |
Gene name | ADP ribosylation factor guanine nucleotide exchange factor 2 | transducin beta like 2 | |
Synonyms | BIG2|PVNH2|dJ1164I10.1 | WBSCR13|WS-betaTRP | |
Cytomap | 20q13.13 | 7q11.23 | |
Type of gene | protein-coding | protein-coding | |
Description | brefeldin A-inhibited guanine nucleotide-exchange protein 2ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)brefeldin A-inhibited GEP 2 | transducin beta-like protein 2WS beta-transducin repeats proteinWilliams-Beuren syndrome chromosome region 13epididymis secretory sperm binding proteintransducin -like 2 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q9Y6D5 Main function of 5'-partner protein: FUNCTION: Promotes guanine-nucleotide exchange on ARF1 and ARF3 and to a lower extent on ARF5 and ARF6. Promotes the activation of ARF1/ARF5/ARF6 through replacement of GDP with GTP. Involved in the regulation of Golgi vesicular transport. Required for the integrity of the endosomal compartment. Involved in trafficking from the trans-Golgi network (TGN) to endosomes and is required for membrane association of the AP-1 complex and GGA1. Seems to be involved in recycling of the transferrin receptor from recycling endosomes to the plasma membrane. Probably is involved in the exit of GABA(A) receptors from the endoplasmic reticulum. Involved in constitutive release of tumor necrosis factor receptor 1 via exosome-like vesicles; the function seems to involve PKA and specifically PRKAR2B. Proposed to act as A kinase-anchoring protein (AKAP) and may mediate crosstalk between Arf and PKA pathways. {ECO:0000269|PubMed:12051703, ECO:0000269|PubMed:12571360, ECO:0000269|PubMed:15385626, ECO:0000269|PubMed:16477018, ECO:0000269|PubMed:17276987, ECO:0000269|PubMed:18625701, ECO:0000269|PubMed:20360857}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000371917, ENST00000493140, | ENST00000432538, ENST00000459913, ENST00000452475, ENST00000305632, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 15 X 13 X 9=1755 | 3 X 4 X 3=36 |
# samples | 15 | 3 | |
** MAII score | log2(15/1755*10)=-3.54843662469604 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/36*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ARFGEF2 [Title/Abstract] AND TBL2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ARFGEF2 [Title/Abstract] AND TBL2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ARFGEF2(47592736)-TBL2(72985671), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ARFGEF2-TBL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARFGEF2-TBL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARFGEF2-TBL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ARFGEF2-TBL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ARFGEF2 | GO:0001881 | receptor recycling | 16477018 |
Hgene | ARFGEF2 | GO:0035556 | intracellular signal transduction | 12571360 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:47592736/chr7:72985671) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000371917 | ARFGEF2 | chr20 | 47592736 | + | ENST00000305632 | TBL2 | chr7 | 72985671 | - | 4152 | 1958 | 0 | 2576 | 858 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000371917 | ENST00000305632 | ARFGEF2 | chr20 | 47592736 | + | TBL2 | chr7 | 72985671 | - | 0.001232603 | 0.9987674 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ARFGEF2-TBL2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ARFGEF2 | chr20 | 47592736 | TBL2 | chr7 | 72985671 | 1958 | 653 | KQQKEIIEHGIELFVASCGFTPDVKV |
Top |
Potential FusionNeoAntigen Information of ARFGEF2-TBL2 in HLA I |
![]() |
ARFGEF2-TBL2_47592736_72985671.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B18:01 | IEHGIELF | 0.9992 | 0.9562 | 6 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B47:01 | IEHGIELF | 0.9987 | 0.5865 | 6 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B39:06 | EHGIELFVA | 0.9958 | 0.9299 | 7 | 16 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B47:01 | IEHGIELFV | 0.6007 | 0.7025 | 6 | 15 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B50:01 | IEHGIELFV | 0.3283 | 0.7689 | 6 | 15 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B52:01 | IEHGIELFV | 0.1668 | 0.9916 | 6 | 15 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B50:01 | IEHGIELFVA | 0.7353 | 0.8237 | 6 | 16 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B44:03 | KEIIEHGIELF | 0.9997 | 0.8263 | 3 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-C05:09 | IIEHGIELF | 0.9993 | 0.9692 | 5 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B40:06 | IEHGIELFV | 0.9945 | 0.6444 | 6 | 15 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B39:05 | EHGIELFVA | 0.9932 | 0.9778 | 7 | 16 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B40:06 | IEHGIELFVA | 0.9749 | 0.6984 | 6 | 16 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B18:08 | IEHGIELF | 0.9992 | 0.8594 | 6 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B18:05 | IEHGIELF | 0.9992 | 0.9562 | 6 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B18:06 | IEHGIELF | 0.9992 | 0.9597 | 6 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B18:04 | IEHGIELF | 0.9989 | 0.9612 | 6 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B18:03 | IEHGIELF | 0.9988 | 0.9525 | 6 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B18:11 | IEHGIELF | 0.993 | 0.9249 | 6 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-C04:03 | IIEHGIELF | 0.9993 | 0.7588 | 5 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-C05:01 | IIEHGIELF | 0.9993 | 0.9692 | 5 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B40:04 | IEHGIELFV | 0.9246 | 0.7516 | 6 | 15 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B50:04 | IEHGIELFV | 0.3283 | 0.7689 | 6 | 15 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B50:05 | IEHGIELFV | 0.3283 | 0.7689 | 6 | 15 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-A25:01 | EIIEHGIELF | 0.9992 | 0.9035 | 4 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B15:08 | EIIEHGIELF | 0.9976 | 0.8366 | 4 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B50:04 | IEHGIELFVA | 0.7353 | 0.8237 | 6 | 16 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B50:05 | IEHGIELFVA | 0.7353 | 0.8237 | 6 | 16 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B44:07 | KEIIEHGIELF | 0.9997 | 0.8263 | 3 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B44:26 | KEIIEHGIELF | 0.9997 | 0.8263 | 3 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-B44:13 | KEIIEHGIELF | 0.9997 | 0.8263 | 3 | 14 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-A68:02 | EIIEHGIELFV | 0.9982 | 0.7033 | 4 | 15 |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 | HLA-A69:01 | EIIEHGIELFV | 0.9949 | 0.7066 | 4 | 15 |
Top |
Potential FusionNeoAntigen Information of ARFGEF2-TBL2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ARFGEF2-TBL2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3643 | IEHGIELFVASCGF | ARFGEF2 | TBL2 | chr20 | 47592736 | chr7 | 72985671 | 1958 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ARFGEF2-TBL2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 3643 | IEHGIELFVASCGF | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 3643 | IEHGIELFVASCGF | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 3643 | IEHGIELFVASCGF | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 3643 | IEHGIELFVASCGF | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 3643 | IEHGIELFVASCGF | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 3643 | IEHGIELFVASCGF | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 3643 | IEHGIELFVASCGF | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 3643 | IEHGIELFVASCGF | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 3643 | IEHGIELFVASCGF | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 3643 | IEHGIELFVASCGF | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 3643 | IEHGIELFVASCGF | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of ARFGEF2-TBL2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 3 | 14 | KEIIEHGIELF | AAAAGAAATCATTGAACACGGCATCGAGCTATT |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 4 | 14 | EIIEHGIELF | AGAAATCATTGAACACGGCATCGAGCTATT |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 4 | 15 | EIIEHGIELFV | AGAAATCATTGAACACGGCATCGAGCTATTTGT |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 5 | 14 | IIEHGIELF | AATCATTGAACACGGCATCGAGCTATT |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 6 | 14 | IEHGIELF | CATTGAACACGGCATCGAGCTATT |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 6 | 15 | IEHGIELFV | CATTGAACACGGCATCGAGCTATTTGT |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 6 | 16 | IEHGIELFVA | CATTGAACACGGCATCGAGCTATTTGTAGC |
ARFGEF2-TBL2 | chr20 | 47592736 | chr7 | 72985671 | 7 | 16 | EHGIELFVA | TGAACACGGCATCGAGCTATTTGTAGC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ARFGEF2-TBL2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
ESCA | ARFGEF2-TBL2 | chr20 | 47592736 | ENST00000371917 | chr7 | 72985671 | ENST00000305632 | TCGA-IG-A97H |
Top |
Potential target of CAR-T therapy development for ARFGEF2-TBL2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ARFGEF2-TBL2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ARFGEF2-TBL2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |