FusionNeoAntigen Logo

Home

Download

Statistics

Examples

Help

Contact

Terms of Use

Center for Computational Systems Medicine
leaf

Fusion Gene and Fusion Protein Summary

leaf

Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)

leaf

Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)

leaf

Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)

leaf

Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)

leaf

Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)

leaf

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)

leaf

Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)

leaf

Potential target of CAR-T therapy development

leaf

Information on the samples that have these potential fusion neoantigens

leaf

Fusion Protein Targeting Drugs - (Manual Curation)

leaf

Fusion Protein Related diseases - (Manual Curation)

Fusion Protein:NLK-ELMO1

Fusion Gene and Fusion Protein Summary

check button Fusion gene summary
Fusion partner gene informationFusion gene name: NLK-ELMO1
FusionPDB ID: 59345
FusionGDB2.0 ID: 59345
HgeneTgene
Gene symbol

NLK

ELMO1

Gene ID

51701

9844

Gene namenemo like kinaseengulfment and cell motility 1
Synonyms-CED-12|CED12|ELMO-1
Cytomap

17q11.2

7p14.2-p14.1

Type of geneprotein-codingprotein-coding
Descriptionserine/threonine-protein kinase NLKengulfment and cell motility protein 1ced-12 homolog 1
Modification date2020031320200313
UniProtAcc

Q9UBE8

Main function of 5'-partner protein: FUNCTION: Serine/threonine-protein kinase that regulates a number of transcription factors with key roles in cell fate determination. Positive effector of the non-canonical Wnt signaling pathway, acting downstream of WNT5A, MAP3K7/TAK1 and HIPK2. Negative regulator of the canonical Wnt/beta-catenin signaling pathway. Binds to and phosphorylates TCF7L2/TCF4 and LEF1, promoting the dissociation of the TCF7L2/LEF1/beta-catenin complex from DNA, as well as the ubiquitination and subsequent proteolysis of LEF1. Together these effects inhibit the transcriptional activation of canonical Wnt/beta-catenin target genes. Negative regulator of the Notch signaling pathway. Binds to and phosphorylates NOTCH1, thereby preventing the formation of a transcriptionally active ternary complex of NOTCH1, RBPJ/RBPSUH and MAML1. Negative regulator of the MYB family of transcription factors. Phosphorylation of MYB leads to its subsequent proteolysis while phosphorylation of MYBL1 and MYBL2 inhibits their interaction with the coactivator CREBBP. Other transcription factors may also be inhibited by direct phosphorylation of CREBBP itself. Acts downstream of IL6 and MAP3K7/TAK1 to phosphorylate STAT3, which is in turn required for activation of NLK by MAP3K7/TAK1. Upon IL1B stimulus, cooperates with ATF5 to activate the transactivation activity of C/EBP subfamily members. Phosphorylates ATF5 but also stabilizes ATF5 protein levels in a kinase-independent manner (PubMed:25512613). {ECO:0000250|UniProtKB:O54949, ECO:0000269|PubMed:12482967, ECO:0000269|PubMed:14960582, ECO:0000269|PubMed:15004007, ECO:0000269|PubMed:15764709, ECO:0000269|PubMed:20061393, ECO:0000269|PubMed:20118921, ECO:0000269|PubMed:20874444, ECO:0000269|PubMed:21454679, ECO:0000269|PubMed:25512613}.

Q92556

Main function of 5'-partner protein: FUNCTION: Involved in cytoskeletal rearrangements required for phagocytosis of apoptotic cells and cell motility. Acts in association with DOCK1 and CRK. Was initially proposed to be required in complex with DOCK1 to activate Rac Rho small GTPases. May enhance the guanine nucleotide exchange factor (GEF) activity of DOCK1. {ECO:0000269|PubMed:11595183, ECO:0000269|PubMed:12134158}.
Ensembl transtripts involved in fusion geneENST idsENST00000407008, ENST00000582037, 
ENST00000583517, 
ENST00000310758, 
ENST00000396040, ENST00000396045, 
ENST00000442504, ENST00000448602, 
ENST00000479447, ENST00000341056, 
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)* DoF score18 X 10 X 9=162017 X 13 X 9=1989
# samples 2018
** MAII scorelog2(20/1620*10)=-3.01792190799726
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(18/1989*10)=-3.46597446450407
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Fusion gene context

PubMed: NLK [Title/Abstract] AND ELMO1 [Title/Abstract] AND fusion [Title/Abstract]

Fusion neoantigen context

PubMed: NLK [Title/Abstract] AND ELMO1 [Title/Abstract] AND neoantigen [Title/Abstract]

Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)NLK(26449758)-ELMO1(37172839), # samples:2
Anticipated loss of major functional domain due to fusion event.NLK-ELMO1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF.
NLK-ELMO1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF.
NLK-ELMO1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.
NLK-ELMO1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneNLK

GO:0050821

protein stabilization

25512613



check button Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:26449758/chr7:37172839)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.
FGviewer

check buttonRetention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

check buttonFusion gene breakpoints across NLK (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
all structure

check buttonFusion gene breakpoints across ELMO1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
all structure


Top

Fusion Amino Acid Sequences


check buttonFusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.
HenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrandSeq length
(transcript)
BP loci
(transcript)
Predicted start
(transcript)
Predicted stop
(transcript)
Seq length
(amino acids)
ENST00000407008NLKchr1726449758+ENST00000341056ELMO1chr737172839-359913067182403561

check buttonDeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.
HenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrandNo-coding scoreCoding score
ENST00000407008ENST00000341056NLKchr1726449758+ELMO1chr737172839-0.007082790.9929172

check button Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NLK-ELMO1

check button +/-13 AA sequence from the breakpoints of the fusion protein sequences.
HgeneHchrHbpTgeneTchrTbpLength(fusion protein)BP in fusion proteinPeptide
NLKchr1726449758ELMO1chr7371728391306196RELKMLCFFKHDNNHVNPAMDFTQTP

Top

Potential FusionNeoAntigen Information of NLK-ELMO1 in HLA I

check button Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.
NLK-ELMO1_26449758_37172839.msa

check button Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)
Fusion geneHchrHbpTgeneTchrTbpHLA IFusionNeoAntigen peptideBinding scoreImmunogenic scoreNeoantigen start (at BP 13)Neoantigen end (at BP 13)
NLK-ELMO1chr1726449758chr7371728391306HLA-B15:18NNHVNPAMDF0.91010.67221222
NLK-ELMO1chr1726449758chr7371728391306HLA-B38:01NNHVNPAMDF0.66250.8451222
NLK-ELMO1chr1726449758chr7371728391306HLA-B38:02NNHVNPAMDF0.5990.86571222
NLK-ELMO1chr1726449758chr7371728391306HLA-B38:01KHDNNHVNPAM0.99570.9465920
NLK-ELMO1chr1726449758chr7371728391306HLA-B39:05KHDNNHVNPAM0.99590.9084920
NLK-ELMO1chr1726449758chr7371728391306HLA-B38:05NNHVNPAMDF0.66250.8451222
NLK-ELMO1chr1726449758chr7371728391306HLA-B39:11KHDNNHVNPAM0.99750.6575920
NLK-ELMO1chr1726449758chr7371728391306HLA-B38:05KHDNNHVNPAM0.99570.9465920

Top

Potential FusionNeoAntigen Information of NLK-ELMO1 in HLA II

check button Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

check button Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).
Fusion geneHchrHbpTgeneTchrTbpHLA IIFusionNeoAntigen peptideNeoantigen start (at BP 13)Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NLK-ELMO1

check button3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.
File nameBPseqHgeneTgeneHchrHbpTchrTbpAAlen
811CFFKHDNNHVNPAMNLKELMO1chr1726449758chr7371728391306

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NLK-ELMO1

check buttonVirtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.
HLA allelePDB IDFile nameBPseqDocking scoreGlide score
HLA-B14:023BVN811CFFKHDNNHVNPAM-6.93863-7.05203
HLA-B14:023BVN811CFFKHDNNHVNPAM-4.13527-5.17057
HLA-B52:013W39811CFFKHDNNHVNPAM-6.86405-6.97745
HLA-B52:013W39811CFFKHDNNHVNPAM-3.72209-4.75739
HLA-A24:025HGA811CFFKHDNNHVNPAM-8.23297-9.26827
HLA-A24:025HGA811CFFKHDNNHVNPAM-5.62477-5.73817
HLA-B27:056PYJ811CFFKHDNNHVNPAM-5.8772-6.9125
HLA-B44:053DX8811CFFKHDNNHVNPAM-6.50682-6.62022
HLA-B44:053DX8811CFFKHDNNHVNPAM-4.20591-5.24121

Top

Vaccine Design for the FusionNeoAntigens of NLK-ELMO1

check button mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.
Fusion geneHchrHbpTchrTbpStart in +/-13AAEnd in +/-13AAFusionNeoAntigen peptide sequenceFusionNeoAntigen RNA sequence
NLK-ELMO1chr1726449758chr7371728391222NNHVNPAMDFAATAATCATGTCAACCCTGCCATGGACTTC
NLK-ELMO1chr1726449758chr737172839920KHDNNHVNPAMAAGCATGATAATAATCATGTCAACCCTGCCATG

check button mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.
Fusion geneHchrHbpTchrTbpStart in +/-13AAEnd in +/-13AAFusionNeoAntigen peptideFusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NLK-ELMO1

check button These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.
Cancer typeFusion geneHchrHbpHenstTchrTbpTenstSample
LGGNLK-ELMO1chr1726449758ENST00000407008chr737172839ENST00000341056TCGA-FG-A70Z-01A

Top

Potential target of CAR-T therapy development for NLK-ELMO1

check button Predicted 3D structure. We used RoseTTAFold.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features


* Minus value of BPloci means that the break point is located before the CDS.
- In-frame and retained 'Transmembrane'.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

check button Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.
HgeneHchrHbpHenstTgeneTchrTbpTenstDeepLoc result

Top

Related Drugs to NLK-ELMO1

check button Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)
HgeneTgeneDrugSourcePMID

Top

Related Diseases to NLK-ELMO1

check button Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)
HgeneTgeneDiseaseSourcePMID

check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource