![]() |
|||||||
|
Fusion Protein:NOP58-ACTL6A |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: NOP58-ACTL6A | FusionPDB ID: 59650 | FusionGDB2.0 ID: 59650 | Hgene | Tgene | Gene symbol | NOP58 | ACTL6A | Gene ID | 51602 | 86 |
Gene name | NOP58 ribonucleoprotein | actin like 6A | |
Synonyms | HSPC120|NOP5|NOP5/NOP58 | ACTL6|ARPN-BETA|Arp4|BAF53A|INO80K | |
Cytomap | 2q33.1 | 3q26.33 | |
Type of gene | protein-coding | protein-coding | |
Description | nucleolar protein 58NOP58 ribonucleoprotein homolognucleolar protein 5nucleolar protein NOP5/NOP58 | actin-like protein 6A53 kDa BRG1-associated factor ABAF complex 53 kDa subunitBAF53BRG1-associated factor 53AINO80 complex subunit Kactin-related protein 4actin-related protein Baf53aarpNbetahArpN beta | |
Modification date | 20200313 | 20200315 | |
UniProtAcc | Q9Y2X3 Main function of 5'-partner protein: FUNCTION: Required for 60S ribosomal subunit biogenesis (By similarity). Core component of box C/D small nucleolar ribonucleoprotein (snoRNP) particles. Required for the biogenesis of box C/D snoRNAs such as U3, U8 and U14 snoRNAs. {ECO:0000250, ECO:0000269|PubMed:15574333, ECO:0000269|PubMed:17636026, ECO:0000269|PubMed:19620283}. | O96019 Main function of 5'-partner protein: FUNCTION: Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Required for maximal ATPase activity of SMARCA4/BRG1/BAF190A and for association of the SMARCA4/BRG1/BAF190A containing remodeling complex BAF with chromatin/nuclear matrix. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and is required for the proliferation of neural progenitors. During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity). Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage. Putative core component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair. {ECO:0000250|UniProtKB:Q9Z2N8, ECO:0000269|PubMed:14966270, ECO:0000269|PubMed:29374058, ECO:0000303|PubMed:15196461, ECO:0000303|PubMed:22952240, ECO:0000303|PubMed:26601204}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000264279, ENST00000467734, | ENST00000467615, ENST00000392662, ENST00000429709, ENST00000450518, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 9 X 9 X 6=486 | 7 X 7 X 3=147 |
# samples | 10 | 7 | |
** MAII score | log2(10/486*10)=-2.28095631383106 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/147*10)=-1.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: NOP58 [Title/Abstract] AND ACTL6A [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: NOP58 [Title/Abstract] AND ACTL6A [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | NOP58(203157626)-ACTL6A(179291156), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | NOP58-ACTL6A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NOP58-ACTL6A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ACTL6A | GO:0006338 | chromatin remodeling | 11726552 |
Tgene | ACTL6A | GO:0043967 | histone H4 acetylation | 14966270 |
Tgene | ACTL6A | GO:0043968 | histone H2A acetylation | 14966270 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:203157626/chr3:179291156) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000264279 | NOP58 | chr2 | 203157626 | + | ENST00000429709 | ACTL6A | chr3 | 179291156 | + | 2544 | 1133 | 226 | 2145 | 639 |
ENST00000264279 | NOP58 | chr2 | 203157626 | + | ENST00000450518 | ACTL6A | chr3 | 179291156 | + | 2543 | 1133 | 226 | 2145 | 639 |
ENST00000264279 | NOP58 | chr2 | 203157626 | + | ENST00000392662 | ACTL6A | chr3 | 179291156 | + | 2534 | 1133 | 226 | 2145 | 639 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000264279 | ENST00000429709 | NOP58 | chr2 | 203157626 | + | ACTL6A | chr3 | 179291156 | + | 0.00130006 | 0.9986999 |
ENST00000264279 | ENST00000450518 | NOP58 | chr2 | 203157626 | + | ACTL6A | chr3 | 179291156 | + | 0.001296001 | 0.99870396 |
ENST00000264279 | ENST00000392662 | NOP58 | chr2 | 203157626 | + | ACTL6A | chr3 | 179291156 | + | 0.001318704 | 0.99868125 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for NOP58-ACTL6A |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
NOP58 | chr2 | 203157626 | ACTL6A | chr3 | 179291156 | 1133 | 302 | VGELVGARLIAHAVEDWDSFQAILDH |
Top |
Potential FusionNeoAntigen Information of NOP58-ACTL6A in HLA I |
![]() |
NOP58-ACTL6A_203157626_179291156.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:08 | HAVEDWDSF | 0.9965 | 0.844 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:01 | HAVEDWDSF | 0.9929 | 0.8605 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:05 | HAVEDWDSF | 0.9749 | 0.6726 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:03 | HAVEDWDSF | 0.9554 | 0.8839 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:02 | HAVEDWDSF | 0.7599 | 0.9468 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:04 | HAVEDWDSF | 0.7599 | 0.9468 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-A32:13 | RLIAHAVEDW | 0.9801 | 0.9503 | 7 | 17 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B38:02 | AHAVEDWDSF | 0.9669 | 0.8334 | 10 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B38:01 | AHAVEDWDSF | 0.9605 | 0.8598 | 10 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B15:31 | HAVEDWDSF | 0.9934 | 0.848 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B15:21 | HAVEDWDSF | 0.992 | 0.8754 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:12 | HAVEDWDSF | 0.7599 | 0.9468 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-C03:14 | HAVEDWDSF | 0.7593 | 0.9593 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-C03:02 | HAVEDWDSF | 0.9953 | 0.9704 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:77 | HAVEDWDSF | 0.9929 | 0.8605 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:23 | HAVEDWDSF | 0.9922 | 0.8943 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:20 | HAVEDWDSF | 0.9921 | 0.8894 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:11 | HAVEDWDSF | 0.9918 | 0.8657 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B15:13 | HAVEDWDSF | 0.9798 | 0.8971 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:30 | HAVEDWDSF | 0.9778 | 0.7886 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:17 | HAVEDWDSF | 0.9778 | 0.7886 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:13 | HAVEDWDSF | 0.9321 | 0.8896 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-A25:01 | HAVEDWDSF | 0.9293 | 0.7398 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B15:11 | HAVEDWDSF | 0.9139 | 0.8068 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B15:08 | HAVEDWDSF | 0.9123 | 0.8009 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:24 | HAVEDWDSF | 0.902 | 0.856 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:43 | HAVEDWDSF | 0.8829 | 0.7988 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-C12:02 | HAVEDWDSF | 0.7905 | 0.9451 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-C03:06 | HAVEDWDSF | 0.7871 | 0.9891 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B35:09 | HAVEDWDSF | 0.7599 | 0.9468 | 11 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B15:24 | RLIAHAVEDW | 0.9986 | 0.889 | 7 | 17 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-A32:01 | RLIAHAVEDW | 0.994 | 0.9706 | 7 | 17 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B38:05 | AHAVEDWDSF | 0.9605 | 0.8598 | 10 | 20 |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 | HLA-B39:11 | AHAVEDWDSF | 0.9341 | 0.6974 | 10 | 20 |
Top |
Potential FusionNeoAntigen Information of NOP58-ACTL6A in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of NOP58-ACTL6A |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
552 | ARLIAHAVEDWDSF | NOP58 | ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 1133 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NOP58-ACTL6A |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 552 | ARLIAHAVEDWDSF | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 552 | ARLIAHAVEDWDSF | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 552 | ARLIAHAVEDWDSF | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 552 | ARLIAHAVEDWDSF | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 552 | ARLIAHAVEDWDSF | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 552 | ARLIAHAVEDWDSF | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 552 | ARLIAHAVEDWDSF | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 552 | ARLIAHAVEDWDSF | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 552 | ARLIAHAVEDWDSF | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 552 | ARLIAHAVEDWDSF | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 552 | ARLIAHAVEDWDSF | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of NOP58-ACTL6A |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 10 | 20 | AHAVEDWDSF | CTCATGCAGTTGAAGACTGGGATAGTTTCC |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 11 | 20 | HAVEDWDSF | ATGCAGTTGAAGACTGGGATAGTTTCC |
NOP58-ACTL6A | chr2 | 203157626 | chr3 | 179291156 | 7 | 17 | RLIAHAVEDW | GGCTTATTGCTCATGCAGTTGAAGACTGGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of NOP58-ACTL6A |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
ESCA | NOP58-ACTL6A | chr2 | 203157626 | ENST00000264279 | chr3 | 179291156 | ENST00000392662 | TCGA-VR-AA7D |
Top |
Potential target of CAR-T therapy development for NOP58-ACTL6A |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to NOP58-ACTL6A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to NOP58-ACTL6A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |