Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NSD1-NCKIPSD

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NSD1-NCKIPSD
	FusionPDB ID: 60428
	FusionGDB2.0 ID: 60428
		Hgene	Tgene
	Gene symbol	NSD1	NCKIPSD
	Gene ID	64324	51517
	Gene name	nuclear receptor binding SET domain protein 1	NCK interacting protein with SH3 domain
	Synonyms	ARA267\|KMT3B\|SOTOS\|SOTOS1\|STO	AF3P21\|DIP\|DIP1\|ORF1\|SPIN90\|VIP54\|WASLBP\|WISH
	Cytomap	5q35.3	3p21.31
	Type of gene	protein-coding	protein-coding
	Description	histone-lysine N-methyltransferase, H3 lysine-36 and H4 lysine-20 specificH3-K36-HMTaseH4-K20-HMTaseNR-binding SET domain-containing proteinandrogen receptor coactivator 267 kDa proteinandrogen receptor-associated coregulator 267androgen receptor-as	NCK-interacting protein with SH3 domain54 kDa VacA-interacting protein54 kDa vimentin-interacting protein90 kDa SH3 protein interacting with NckSH3 adapter protein SPIN90SH3 protein interacting with Nck, 90 kDaWASP-interacting SH3-domain proteindia
	Modification date	20200321	20200313
	UniProtAcc	.	Q9NZQ3 Main function of 5'-partner protein: FUNCTION: Has an important role in stress fiber formation induced by active diaphanous protein homolog 1 (DRF1). Induces microspike formation, in vivo (By similarity). In vitro, stimulates N-WASP-induced ARP2/3 complex activation in the absence of CDC42 (By similarity). May play an important role in the maintenance of sarcomeres and/or in the assembly of myofibrils into sarcomeres. Implicated in regulation of actin polymerization and cell adhesion. Plays a role in angiogenesis. {ECO:0000250, ECO:0000269\|PubMed:22419821}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000347982, ENST00000354179, ENST00000361032, ENST00000439151, ENST00000511258,	ENST00000294129, ENST00000341520, ENST00000416649,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	23 X 14 X 17=5474	4 X 6 X 3=72
	# samples	37	4
	** MAII score	log2(37/5474*10)=-3.88699825884864 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/72*10)=-0.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NSD1 [Title/Abstract] AND NCKIPSD [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NSD1 [Title/Abstract] AND NCKIPSD [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NSD1(176563031)-NCKIPSD(48717662), # samples:1
Anticipated loss of major functional domain due to fusion event.	NSD1-NCKIPSD seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NSD1-NCKIPSD seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NSD1-NCKIPSD seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NSD1-NCKIPSD seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NSD1	GO:0045893	positive regulation of transcription, DNA-templated	11509567

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:176563031/chr3:48717662)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NSD1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NCKIPSD (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000354179	NSD1	chr5	176563031	+	ENST00000341520	NCKIPSD	chr3	48717662	-	1357	280	160	1356	399
ENST00000354179	NSD1	chr5	176563031	+	ENST00000416649	NCKIPSD	chr3	48717662	-	2057	280	160	1356	398
ENST00000354179	NSD1	chr5	176563031	+	ENST00000294129	NCKIPSD	chr3	48717662	-	2057	280	160	1356	398
ENST00000439151	NSD1	chr5	176563031	+	ENST00000341520	NCKIPSD	chr3	48717662	-	2049	972	45	2048	667
ENST00000439151	NSD1	chr5	176563031	+	ENST00000416649	NCKIPSD	chr3	48717662	-	2749	972	45	2048	667
ENST00000439151	NSD1	chr5	176563031	+	ENST00000294129	NCKIPSD	chr3	48717662	-	2749	972	45	2048	667
ENST00000347982	NSD1	chr5	176563031	+	ENST00000341520	NCKIPSD	chr3	48717662	-	1298	221	101	1297	399
ENST00000347982	NSD1	chr5	176563031	+	ENST00000416649	NCKIPSD	chr3	48717662	-	1998	221	101	1297	398
ENST00000347982	NSD1	chr5	176563031	+	ENST00000294129	NCKIPSD	chr3	48717662	-	1998	221	101	1297	398
ENST00000361032	NSD1	chr5	176563031	+	ENST00000341520	NCKIPSD	chr3	48717662	-	2004	927	0	2003	667
ENST00000361032	NSD1	chr5	176563031	+	ENST00000416649	NCKIPSD	chr3	48717662	-	2704	927	0	2003	667
ENST00000361032	NSD1	chr5	176563031	+	ENST00000294129	NCKIPSD	chr3	48717662	-	2704	927	0	2003	667
ENST00000511258	NSD1	chr5	176563031	+	ENST00000341520	NCKIPSD	chr3	48717662	-	1354	277	157	1353	399
ENST00000511258	NSD1	chr5	176563031	+	ENST00000416649	NCKIPSD	chr3	48717662	-	2054	277	157	1353	398
ENST00000511258	NSD1	chr5	176563031	+	ENST00000294129	NCKIPSD	chr3	48717662	-	2054	277	157	1353	398

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000354179	ENST00000341520	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.004000316	0.9959997
ENST00000354179	ENST00000416649	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.003649063	0.9963509
ENST00000354179	ENST00000294129	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.003649063	0.9963509
ENST00000439151	ENST00000341520	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.003293981	0.99670607
ENST00000439151	ENST00000416649	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.004641249	0.99535877
ENST00000439151	ENST00000294129	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.004641249	0.99535877
ENST00000347982	ENST00000341520	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.003839942	0.99616003
ENST00000347982	ENST00000416649	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.00359072	0.99640924
ENST00000347982	ENST00000294129	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.00359072	0.99640924
ENST00000361032	ENST00000341520	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.003493077	0.99650687
ENST00000361032	ENST00000416649	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.004921063	0.9950789
ENST00000361032	ENST00000294129	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.004921063	0.9950789
ENST00000511258	ENST00000341520	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.003536913	0.9964631
ENST00000511258	ENST00000416649	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.003140338	0.99685967
ENST00000511258	ENST00000294129	NSD1	chr5	176563031	+	NCKIPSD	chr3	48717662	-	0.003140338	0.99685967

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NSD1-NCKIPSD

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NSD1	chr5	176563031	NCKIPSD	chr3	48717662	221	40	GTSSSSTSQELPFDLSMALPSGQVCH
NSD1	chr5	176563031	NCKIPSD	chr3	48717662	277	40	GTSSSSTSQELPFDLSMALPSGQVCH
NSD1	chr5	176563031	NCKIPSD	chr3	48717662	280	40	GTSSSSTSQELPFDLSMALPSGQVCH
NSD1	chr5	176563031	NCKIPSD	chr3	48717662	927	309	GTSSSSTSQELPFDLSMALPSGQVCH
NSD1	chr5	176563031	NCKIPSD	chr3	48717662	972	309	GTSSSSTSQELPFDLSMALPSGQVCH

Top

Potential FusionNeoAntigen Information of NSD1-NCKIPSD in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NSD1-NCKIPSD_176563031_48717662.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:03	PFDLSMAL	0.9574	0.7832	11	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:03	LPFDLSMAL	0.9965	0.8774	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:03	QELPFDLSM	0.9955	0.9767	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:01	LPFDLSMAL	0.9955	0.8843	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:08	LPFDLSMAL	0.9927	0.8906	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B13:01	QELPFDLSM	0.9911	0.9637	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B47:01	QELPFDLSM	0.9909	0.726	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B14:02	LPFDLSMAL	0.9847	0.7687	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B14:01	LPFDLSMAL	0.9847	0.7687	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:01	QELPFDLSM	0.9846	0.9501	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:04	LPFDLSMAL	0.9838	0.949	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:02	LPFDLSMAL	0.9838	0.949	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:05	LPFDLSMAL	0.9831	0.5913	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:24	LPFDLSMAL	0.9798	0.5571	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:37	LPFDLSMAL	0.9719	0.7056	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B50:02	QELPFDLSM	0.9585	0.6376	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:10	LPFDLSMAL	0.9571	0.6574	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:01	LPFDLSMAL	0.9471	0.9693	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B45:01	QELPFDLSM	0.8897	0.9808	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:13	QELPFDLSM	0.8091	0.9704	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B38:02	QELPFDLSM	0.7649	0.9846	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B08:01	LPFDLSMAL	0.7468	0.869	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B08:09	LPFDLSMAL	0.632	0.7756	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B41:01	QELPFDLSM	0.2805	0.9911	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B50:01	QELPFDLSM	0.2398	0.7094	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B45:01	QELPFDLSMA	0.9661	0.9828	8	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B50:02	QELPFDLSMA	0.9438	0.7048	8	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B47:01	SQELPFDLSM	0.9027	0.6782	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B13:01	SQELPFDLSM	0.8939	0.9589	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:03	ELPFDLSMAL	0.8124	0.9049	9	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B50:01	QELPFDLSMA	0.7646	0.7874	8	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:02	ELPFDLSMAL	0.7516	0.9291	9	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:04	ELPFDLSMAL	0.7516	0.9291	9	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B41:01	QELPFDLSMA	0.6942	0.9907	8	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:03	QELPFDLSMAL	0.9937	0.9799	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B47:01	QELPFDLSMAL	0.9925	0.7591	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:03	QELPFDLSMAL	0.9873	0.9307	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:04	QELPFDLSMAL	0.9799	0.9783	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:02	QELPFDLSMAL	0.9799	0.9783	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:13	QELPFDLSMAL	0.9554	0.9824	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B41:02	QELPFDLSMAL	0.9414	0.5423	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-C04:07	PFDLSMAL	0.9992	0.7831	11	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-C04:10	PFDLSMAL	0.9991	0.777	11	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B78:01	LPFDLSMA	0.9977	0.5749	10	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:10	PFDLSMAL	0.8317	0.9382	11	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B40:06	QELPFDLSM	0.9968	0.6378	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:31	LPFDLSMAL	0.9926	0.8485	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:12	LPFDLSMAL	0.9838	0.949	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B40:03	QELPFDLSM	0.9728	0.539	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B14:03	LPFDLSMAL	0.9693	0.7712	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:09	LPFDLSMAL	0.9671	0.7399	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:21	LPFDLSMAL	0.9666	0.9371	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B51:07	LPFDLSMAL	0.9545	0.734	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B78:01	LPFDLSMAL	0.9489	0.5136	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:10	LPFDLSMAL	0.9489	0.969	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B07:12	LPFDLSMAL	0.9174	0.642	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B42:02	LPFDLSMAL	0.9031	0.8681	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:05	LPFDLSMAL	0.8547	0.9635	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B42:01	LPFDLSMAL	0.854	0.8594	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:08	QELPFDLSM	0.6902	0.9574	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B40:03	SQELPFDLSM	0.9631	0.5118	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:05	SQELPFDLSM	0.8972	0.9237	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B40:06	QELPFDLSMA	0.8901	0.7355	8	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:12	ELPFDLSMAL	0.7516	0.9291	9	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:10	ELPFDLSMAL	0.6533	0.9667	9	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B40:03	QELPFDLSMAL	0.9906	0.5517	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:12	QELPFDLSMAL	0.9799	0.9783	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:10	QELPFDLSMAL	0.9726	0.5524	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:10	QELPFDLSMAL	0.9552	0.9676	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B07:12	QELPFDLSMAL	0.9477	0.5973	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B42:01	QELPFDLSMAL	0.9253	0.9267	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-C18:01	PFDLSMAL	0.9994	0.7794	11	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-C04:01	PFDLSMAL	0.9992	0.7831	11	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B78:02	LPFDLSMA	0.9984	0.6127	10	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B67:01	PFDLSMAL	0.8514	0.8574	11	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:23	LPFDLSMAL	0.9965	0.8907	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B40:04	QELPFDLSM	0.9956	0.774	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:26	QELPFDLSM	0.9955	0.9767	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:13	QELPFDLSM	0.9955	0.9767	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:77	LPFDLSMAL	0.9955	0.8843	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:07	QELPFDLSM	0.9955	0.9767	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:13	LPFDLSMAL	0.9948	0.8815	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:20	LPFDLSMAL	0.9923	0.9164	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:04	QELPFDLSM	0.9915	0.9601	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:07	QELPFDLSM	0.9894	0.92	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:08	QELPFDLSM	0.9853	0.9193	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:05	QELPFDLSM	0.9846	0.9501	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:09	LPFDLSMAL	0.9838	0.949	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:06	QELPFDLSM	0.9822	0.9577	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:17	LPFDLSMAL	0.9814	0.7428	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:30	LPFDLSMAL	0.9814	0.7428	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:24	LPFDLSMAL	0.9811	0.929	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:11	LPFDLSMAL	0.9768	0.9281	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:11	QELPFDLSM	0.9721	0.9511	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:03	QELPFDLSM	0.9698	0.9459	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B78:02	LPFDLSMAL	0.9618	0.5461	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B67:01	LPFDLSMAL	0.9597	0.9076	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:02	LPFDLSMAL	0.955	0.9722	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:31	LPFDLSMAL	0.9517	0.9689	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:09	LPFDLSMAL	0.8778	0.6783	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:02	QELPFDLSM	0.816	0.9693	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:04	LPFDLSMAL	0.8107	0.9338	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:11	LPFDLSMAL	0.8024	0.9187	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:31	QELPFDLSM	0.7999	0.9713	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B08:12	LPFDLSMAL	0.7836	0.927	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-C04:04	LPFDLSMAL	0.7801	0.9073	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B08:18	LPFDLSMAL	0.7468	0.869	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:20	QELPFDLSM	0.7233	0.976	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:07	LPFDLSMAL	0.6693	0.8899	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B48:02	QELPFDLSM	0.6503	0.9658	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:11	QELPFDLSM	0.6359	0.9496	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:28	QELPFDLSM	0.6285	0.97	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B41:03	QELPFDLSM	0.522	0.8538	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:53	QELPFDLSM	0.3731	0.8915	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B50:05	QELPFDLSM	0.2398	0.7094	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B50:04	QELPFDLSM	0.2398	0.7094	8	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:43	LPFDLSMAL	0.0569	0.8893	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:08	LPFDLSMAL	0.0347	0.8855	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:11	LPFDLSMAL	0.0332	0.8808	10	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:73	SQELPFDLSM	0.9712	0.8057	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B40:04	SQELPFDLSM	0.9627	0.779	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:30	SQELPFDLSM	0.9599	0.7978	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B15:20	SQELPFDLSM	0.8832	0.9659	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:28	SQELPFDLSM	0.8775	0.9717	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B18:11	SQELPFDLSM	0.8102	0.9328	7	17
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B50:04	QELPFDLSMA	0.7646	0.7874	8	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B50:05	QELPFDLSMA	0.7646	0.7874	8	18
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:09	ELPFDLSMAL	0.7516	0.9291	9	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B67:01	ELPFDLSMAL	0.6318	0.7511	9	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:24	ELPFDLSMAL	0.613	0.9346	9	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:07	QELPFDLSMAL	0.9937	0.9799	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:26	QELPFDLSMAL	0.9937	0.9799	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B44:13	QELPFDLSMAL	0.9937	0.9799	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B40:04	QELPFDLSMAL	0.9897	0.7841	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B35:09	QELPFDLSMAL	0.9799	0.9783	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B67:01	QELPFDLSMAL	0.9697	0.9284	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B39:02	QELPFDLSMAL	0.9637	0.9834	8	19
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	221	HLA-B41:03	QELPFDLSMAL	0.9263	0.8261	8	19

Top

Potential FusionNeoAntigen Information of NSD1-NCKIPSD in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NSD1-NCKIPSD

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9657	TSQELPFDLSMALP	NSD1	NCKIPSD	chr5	176563031	chr3	48717662	221

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NSD1-NCKIPSD

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9657	TSQELPFDLSMALP	-6.18902	-6.30242
HLA-B14:02	3BVN	9657	TSQELPFDLSMALP	-5.51674	-6.55204
HLA-B52:01	3W39	9657	TSQELPFDLSMALP	-6.26372	-6.37712
HLA-B52:01	3W39	9657	TSQELPFDLSMALP	-2.88933	-3.92463
HLA-A11:01	4UQ2	9657	TSQELPFDLSMALP	-8.95966	-9.99496
HLA-A24:02	5HGA	9657	TSQELPFDLSMALP	-7.97421	-8.08761
HLA-A24:02	5HGA	9657	TSQELPFDLSMALP	-4.46014	-5.49544
HLA-B44:05	3DX8	9657	TSQELPFDLSMALP	-4.21738	-4.33078
HLA-B44:05	3DX8	9657	TSQELPFDLSMALP	-3.79801	-4.83331
HLA-A02:01	6TDR	9657	TSQELPFDLSMALP	-6.07498	-7.11028

Top

Vaccine Design for the FusionNeoAntigens of NSD1-NCKIPSD

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	10	18	LPFDLSMA	TTGCCATTTGACCTCAGCATGGCC
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	10	19	LPFDLSMAL	TTGCCATTTGACCTCAGCATGGCCCTG
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	11	19	PFDLSMAL	CCATTTGACCTCAGCATGGCCCTG
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	7	17	SQELPFDLSM	TCACAGGAATTGCCATTTGACCTCAGCATG
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	8	17	QELPFDLSM	CAGGAATTGCCATTTGACCTCAGCATG
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	8	18	QELPFDLSMA	CAGGAATTGCCATTTGACCTCAGCATGGCC
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	8	19	QELPFDLSMAL	CAGGAATTGCCATTTGACCTCAGCATGGCCCTG
NSD1-NCKIPSD	chr5	176563031	chr3	48717662	9	19	ELPFDLSMAL	GAATTGCCATTTGACCTCAGCATGGCCCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NSD1-NCKIPSD

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	NSD1-NCKIPSD	chr5	176563031	ENST00000347982	chr3	48717662	ENST00000294129	TCGA-29-1784-01A

Top

Potential target of CAR-T therapy development for NSD1-NCKIPSD

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NSD1-NCKIPSD

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NSD1-NCKIPSD

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)