Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NUMB-TTLL5

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NUMB-TTLL5
	FusionPDB ID: 60952
	FusionGDB2.0 ID: 60952
		Hgene	Tgene
	Gene symbol	NUMB	TTLL5
	Gene ID	8650	254173
	Gene name	NUMB endocytic adaptor protein	tubulin tyrosine ligase like 10
	Synonyms	C14orf41\|S171\|c14_5527	TTLL5
	Cytomap	14q24.2-q24.3	1p36.33
	Type of gene	protein-coding	protein-coding
	Description	protein numb homologh-Numbnumb homolog	inactive polyglycylase TTLL10tubulin tyrosine ligase-like family, member 10tubulin tyrosine ligase-like family, member 5tubulin--tyrosine ligase-like protein 10
	Modification date	20200313	20200313
	UniProtAcc	NUMBL Main function of 5'-partner protein: 609	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000355058, ENST00000356296, ENST00000359560, ENST00000454166, ENST00000535282, ENST00000544991, ENST00000554521, ENST00000554546, ENST00000555238, ENST00000555394, ENST00000555738, ENST00000556772, ENST00000557597, ENST00000559312, ENST00000560335, ENST00000556600,	ENST00000286650, ENST00000298832, ENST00000554510, ENST00000555422, ENST00000556893, ENST00000556977, ENST00000557636,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	24 X 15 X 9=3240	19 X 18 X 11=3762
	# samples	26	24
	** MAII score	log2(26/3240*10)=-3.63941028474353 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(24/3762*10)=-3.97039353791468 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NUMB [Title/Abstract] AND TTLL5 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NUMB [Title/Abstract] AND TTLL5 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NUMB(73759442)-TTLL5(76286350), # samples:3
Anticipated loss of major functional domain due to fusion event.	NUMB-TTLL5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NUMB-TTLL5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NUMB-TTLL5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NUMB-TTLL5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NUMB-TTLL5 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	TTLL5	GO:0018094	protein polyglycylation	19524510

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:73759442/chr14:76286350)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NUMB (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TTLL5 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000554546	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1511	774	273	1403	376
ENST00000557597	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1416	679	178	1308	376
ENST00000555238	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1457	720	186	1349	387
ENST00000555394	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1507	770	236	1399	387
ENST00000454166	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1205	468	18	1097	359
ENST00000544991	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1205	468	18	1097	359
ENST00000560335	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1226	489	39	1118	359
ENST00000555738	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1193	456	39	1085	348
ENST00000559312	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1226	489	39	1118	359
ENST00000554521	NUMB	chr14	73759442	-	ENST00000557636	TTLL5	chr14	76286350	+	1193	456	39	1085	348

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000554546	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.045907676	0.9540923
ENST00000557597	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.050200246	0.9497998
ENST00000555238	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.030474694	0.9695253
ENST00000555394	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.026342997	0.973657
ENST00000454166	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.04034542	0.9596545
ENST00000544991	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.04034542	0.9596545
ENST00000560335	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.043299876	0.95670015
ENST00000555738	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.07183922	0.92816085
ENST00000559312	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.043299876	0.95670015
ENST00000554521	ENST00000557636	NUMB	chr14	73759442	-	TTLL5	chr14	76286350	+	0.07183922	0.92816085

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NUMB-TTLL5

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NUMB	chr14	73759442	TTLL5	chr14	76286350	456	139	RWICHCFMAVKDTVTNLNLATGIINR
NUMB	chr14	73759442	TTLL5	chr14	76286350	468	150	RWICHCFMAVKDTVTNLNLATGIINR
NUMB	chr14	73759442	TTLL5	chr14	76286350	489	150	RWICHCFMAVKDTVTNLNLATGIINR
NUMB	chr14	73759442	TTLL5	chr14	76286350	679	167	RWICHCFMAVKDTVTNLNLATGIINR
NUMB	chr14	73759442	TTLL5	chr14	76286350	720	178	RWICHCFMAVKDTVTNLNLATGIINR
NUMB	chr14	73759442	TTLL5	chr14	76286350	770	178	RWICHCFMAVKDTVTNLNLATGIINR
NUMB	chr14	73759442	TTLL5	chr14	76286350	774	167	RWICHCFMAVKDTVTNLNLATGIINR

Top

Potential FusionNeoAntigen Information of NUMB-TTLL5 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NUMB-TTLL5_73759442_76286350.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:38	AVKDTVTNL	0.9269	0.6199	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A30:08	AVKDTVTNL	0.9146	0.7599	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:13	AVKDTVTNL	0.8893	0.5927	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:21	AVKDTVTNL	0.6753	0.6187	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-B13:01	AVKDTVTNL	0.0686	0.9627	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:22	FMAVKDTVTNL	0.9964	0.746	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:11	FMAVKDTVTNL	0.9853	0.6442	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:24	FMAVKDTVTNL	0.9842	0.6172	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:67	FMAVKDTVTNL	0.9842	0.6172	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:30	FMAVKDTVTNL	0.9842	0.6172	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:60	FMAVKDTVTNL	0.9833	0.5895	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:04	FMAVKDTVTNL	0.9827	0.7327	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:16	FMAVKDTVTNL	0.9694	0.5811	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:38	FMAVKDTVTNL	0.9666	0.7664	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:29	FMAVKDTVTNL	0.9467	0.6263	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C12:04	AVKDTVTNL	0.9991	0.9869	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C06:03	AVKDTVTNL	0.9991	0.9845	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C12:12	AVKDTVTNL	0.9989	0.8749	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C15:04	AVKDTVTNL	0.9982	0.9355	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C15:06	AVKDTVTNL	0.9971	0.9363	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:19	AVKDTVTNL	0.9959	0.9827	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:08	AVKDTVTNL	0.9955	0.9305	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C12:16	AVKDTVTNL	0.9948	0.9454	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:07	AVKDTVTNL	0.9935	0.9853	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-B15:07	AVKDTVTNL	0.9922	0.6975	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-B15:04	AVKDTVTNL	0.9915	0.9253	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C04:06	AVKDTVTNL	0.9823	0.9137	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C02:06	AVKDTVTNL	0.8636	0.9606	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:14	AVKDTVTNL	0.6634	0.9766	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C01:17	AVKDTVTNL	0.494	0.9513	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C01:30	AVKDTVTNL	0.4161	0.9542	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:02	FMAVKDTVTNL	0.9968	0.6154	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:05	FMAVKDTVTNL	0.996	0.7233	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:01	FMAVKDTVTNL	0.9842	0.6172	6	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C12:03	AVKDTVTNL	0.9989	0.9635	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C06:17	AVKDTVTNL	0.9984	0.9863	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C06:02	AVKDTVTNL	0.9984	0.9863	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C15:09	AVKDTVTNL	0.9982	0.9355	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C15:02	AVKDTVTNL	0.9969	0.9149	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C12:02	AVKDTVTNL	0.9967	0.9524	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C15:05	AVKDTVTNL	0.9965	0.9349	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:03	AVKDTVTNL	0.9961	0.9903	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:04	AVKDTVTNL	0.9961	0.9903	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:67	AVKDTVTNL	0.9904	0.9849	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:17	AVKDTVTNL	0.9875	0.9744	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C03:05	AVKDTVTNL	0.9874	0.942	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-B15:73	AVKDTVTNL	0.9821	0.8359	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-B07:13	AVKDTVTNL	0.9775	0.755	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:03	AVKDTVTNL	0.9767	0.5281	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-B15:30	AVKDTVTNL	0.9681	0.8285	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C16:02	AVKDTVTNL	0.9571	0.9908	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C06:06	AVKDTVTNL	0.9196	0.9903	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A30:01	AVKDTVTNL	0.9126	0.8364	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C02:10	AVKDTVTNL	0.8779	0.9725	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C02:02	AVKDTVTNL	0.8779	0.9725	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A32:01	AVKDTVTNL	0.8715	0.9101	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C07:22	AVKDTVTNL	0.742	0.6553	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C07:04	AVKDTVTNL	0.7323	0.9429	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C06:08	AVKDTVTNL	0.7282	0.9817	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:06	AVKDTVTNL	0.6753	0.6187	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A25:01	AVKDTVTNL	0.6603	0.7835	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C01:02	AVKDTVTNL	0.5081	0.9526	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-C17:01	AVKDTVTNL	0.237	0.8336	8	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-B35:13	MAVKDTVTNL	0.973	0.9584	7	17
NUMB-TTLL5	chr14	73759442	chr14	76286350	468	HLA-A02:03	FMAVKDTVTNL	0.9974	0.8101	6	17

Top

Potential FusionNeoAntigen Information of NUMB-TTLL5 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NUMB-TTLL5

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2468	FMAVKDTVTNLNLA	NUMB	TTLL5	chr14	73759442	chr14	76286350	468

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NUMB-TTLL5

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2468	FMAVKDTVTNLNLA	-4.9963	-5.1097
HLA-B52:01	3W39	2468	FMAVKDTVTNLNLA	-5.24613	-5.35953
HLA-A11:01	4UQ2	2468	FMAVKDTVTNLNLA	-3.87488	-4.91018
HLA-A24:02	5HGA	2468	FMAVKDTVTNLNLA	-7.5832	-7.6966
HLA-A24:02	5HGA	2468	FMAVKDTVTNLNLA	-6.54552	-7.58082
HLA-B44:05	3DX8	2468	FMAVKDTVTNLNLA	-5.97033	-6.08373
HLA-B44:05	3DX8	2468	FMAVKDTVTNLNLA	-3.29319	-4.32849

Top

Vaccine Design for the FusionNeoAntigens of NUMB-TTLL5

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NUMB-TTLL5	chr14	73759442	chr14	76286350	6	17	FMAVKDTVTNL	TTCATGGCTGTCAAGGACACAGTAACAAACCTG
NUMB-TTLL5	chr14	73759442	chr14	76286350	7	17	MAVKDTVTNL	ATGGCTGTCAAGGACACAGTAACAAACCTG
NUMB-TTLL5	chr14	73759442	chr14	76286350	8	17	AVKDTVTNL	GCTGTCAAGGACACAGTAACAAACCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NUMB-TTLL5

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	NUMB-TTLL5	chr14	73759442	ENST00000454166	chr14	76286350	ENST00000557636	TCGA-YF-AA3L-01A

Top

Potential target of CAR-T therapy development for NUMB-TTLL5

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NUMB-TTLL5

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NUMB-TTLL5

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)