Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:OGT-NONO

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: OGT-NONO
	FusionPDB ID: 61435
	FusionGDB2.0 ID: 61435
		Hgene	Tgene
	Gene symbol	OGT	NONO
	Gene ID	8473	4841
	Gene name	O-linked N-acetylglucosamine (GlcNAc) transferase	non-POU domain containing octamer binding
	Synonyms	HINCUT-1\|HRNT1\|MRX106\|O-GLCNAC\|OGT1	MRXS34\|NMT55\|NRB54\|P54\|P54NRB\|PPP1R114
	Cytomap	Xq13.1	Xq13.1
	Type of gene	protein-coding	protein-coding
	Description	UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase 110 kDa subunitO-GlcNAc transferase p110 subunitO-GlcNAc transferase subunit p110O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminy	non-POU domain-containing octamer-binding protein54 kDa nuclear RNA- and DNA-binding protein55 kDa nuclear proteinDNA-binding p52/p100 complex, 52 kDa subunitnon-POU domain-containing octamer (ATGCAAAT) binding proteinp54(nrb)protein phosphatase 1,
	Modification date	20200327	20200313
	UniProtAcc	.	Q15233 Main function of 5'-partner protein: FUNCTION: DNA- and RNA binding protein, involved in several nuclear processes. Binds the conventional octamer sequence in double-stranded DNA. Also binds single-stranded DNA and RNA at a site independent of the duplex site. Involved in pre-mRNA splicing, probably as a heterodimer with SFPQ. Interacts with U5 snRNA, probably by binding to a purine-rich sequence located on the 3' side of U5 snRNA stem 1b. Together with PSPC1, required for the formation of nuclear paraspeckles. The SFPQ-NONO heteromer associated with MATR3 may play a role in nuclear retention of defective RNAs. The SFPQ-NONO heteromer may be involved in DNA unwinding by modulating the function of topoisomerase I/TOP1. The SFPQ-NONO heteromer may be involved in DNA non-homologous end joining (NHEJ) required for double-strand break repair and V(D)J recombination and may stabilize paired DNA ends. In vitro, the complex strongly stimulates DNA end joining, binds directly to the DNA substrates and cooperates with the Ku70/G22P1-Ku80/XRCC5 (Ku) dimer to establish a functional preligation complex. NONO is involved in transcriptional regulation. The SFPQ-NONO-NR5A1 complex binds to the CYP17 promoter and regulates basal and cAMP-dependent transcriptional activity. NONO binds to an enhancer element in long terminal repeats of endogenous intracisternal A particles (IAPs) and activates transcription. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer. Important for the functional organization of GABAergic synapses. Plays a specific and important role in the regulation of synaptic RNAs and GPHN/gephyrin scaffold structure, through the regulation of GABRA2 transcript. Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway (PubMed:28712728). {ECO:0000250\|UniProtKB:Q99K48, ECO:0000269\|PubMed:10858305, ECO:0000269\|PubMed:11525732, ECO:0000269\|PubMed:11897684, ECO:0000269\|PubMed:15590677, ECO:0000269\|PubMed:22416126, ECO:0000269\|PubMed:26571461, ECO:0000269\|PubMed:28712728}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000373701, ENST00000373719, ENST00000498566,	ENST00000490044, ENST00000276079, ENST00000373841, ENST00000373856, ENST00000535149,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 9 X 4=324	8 X 8 X 3=192
	# samples	10	8
	** MAII score	log2(10/324*10)=-1.6959938131099 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/192*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: OGT [Title/Abstract] AND NONO [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: OGT [Title/Abstract] AND NONO [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	OGT(70774442)-NONO(70516415), # samples:1
Anticipated loss of major functional domain due to fusion event.	OGT-NONO seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. OGT-NONO seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. OGT-NONO seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. OGT-NONO seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	OGT	GO:0006110	regulation of glycolytic process	22923583
Hgene	OGT	GO:0006493	protein O-linked glycosylation	21240259\|21285374\|22923583\|23222540\|23352454\|24474760
Hgene	OGT	GO:0006915	apoptotic process	20824293
Hgene	OGT	GO:0032868	response to insulin	18288188
Hgene	OGT	GO:0035020	regulation of Rac protein signal transduction	18288188
Hgene	OGT	GO:0043981	histone H4-K5 acetylation	20018852
Hgene	OGT	GO:0043982	histone H4-K8 acetylation	20018852
Hgene	OGT	GO:0043984	histone H4-K16 acetylation	20018852
Hgene	OGT	GO:0045862	positive regulation of proteolysis	21285374
Hgene	OGT	GO:0045944	positive regulation of transcription by RNA polymerase II	23222540\|23353889
Hgene	OGT	GO:0046626	regulation of insulin receptor signaling pathway	18288188
Hgene	OGT	GO:0048015	phosphatidylinositol-mediated signaling	18288188
Tgene	NONO	GO:0002218	activation of innate immune response	28712728
Tgene	NONO	GO:1903377	negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway	15790595

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:70774442/chrX:70516415)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across OGT (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NONO (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000373719	OGT	chrX	70774442	+	ENST00000535149	NONO	chrX	70516415	+	2801	945	67	1710	547
ENST00000373719	OGT	chrX	70774442	+	ENST00000276079	NONO	chrX	70516415	+	2803	945	67	1710	547
ENST00000373719	OGT	chrX	70774442	+	ENST00000373856	NONO	chrX	70516415	+	1904	945	67	1710	547
ENST00000373719	OGT	chrX	70774442	+	ENST00000373841	NONO	chrX	70516415	+	2803	945	67	1710	547
ENST00000373701	OGT	chrX	70774442	+	ENST00000535149	NONO	chrX	70516415	+	2731	875	27	1640	537
ENST00000373701	OGT	chrX	70774442	+	ENST00000276079	NONO	chrX	70516415	+	2733	875	27	1640	537
ENST00000373701	OGT	chrX	70774442	+	ENST00000373856	NONO	chrX	70516415	+	1834	875	27	1640	537
ENST00000373701	OGT	chrX	70774442	+	ENST00000373841	NONO	chrX	70516415	+	2733	875	27	1640	537

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000373719	ENST00000535149	OGT	chrX	70774442	+	NONO	chrX	70516415	+	0.002445235	0.99755484
ENST00000373719	ENST00000276079	OGT	chrX	70774442	+	NONO	chrX	70516415	+	0.002416017	0.997584
ENST00000373719	ENST00000373856	OGT	chrX	70774442	+	NONO	chrX	70516415	+	0.00552883	0.9944712
ENST00000373719	ENST00000373841	OGT	chrX	70774442	+	NONO	chrX	70516415	+	0.002416017	0.997584
ENST00000373701	ENST00000535149	OGT	chrX	70774442	+	NONO	chrX	70516415	+	0.003730317	0.9962697
ENST00000373701	ENST00000276079	OGT	chrX	70774442	+	NONO	chrX	70516415	+	0.003680586	0.9963194
ENST00000373701	ENST00000373856	OGT	chrX	70774442	+	NONO	chrX	70516415	+	0.009079591	0.9909204
ENST00000373701	ENST00000373841	OGT	chrX	70774442	+	NONO	chrX	70516415	+	0.003680586	0.9963194

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for OGT-NONO

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
OGT	chrX	70774442	NONO	chrX	70516415	875	282	NLGNVLKEARIFDRFPRPVTVEPMDQ
OGT	chrX	70774442	NONO	chrX	70516415	945	292	NLGNVLKEARIFDRFPRPVTVEPMDQ

Top

Potential FusionNeoAntigen Information of OGT-NONO in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

OGT-NONO_70774442_70516415.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:01	DRFPRPVT	0.9997	0.9203	12	20
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:02	DRFPRPVT	0.9997	0.9203	12	20
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:01	DRFPRPVTV	0.9997	0.9388	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:02	DRFPRPVTV	0.9997	0.9388	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:05	ARIFDRFPR	0.9996	0.7527	8	17
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:07	DRFPRPVTV	0.9995	0.7352	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:04	DRFPRPVTV	0.9994	0.7331	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:06	DRFPRPVTV	0.9993	0.9519	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:24	DRFPRPVTV	0.9992	0.7942	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:05	DRFPRPVTV	0.9987	0.6561	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:01	DRFPRPVTV	0.9981	0.9659	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B38:01	DRFPRPVTV	0.9975	0.9796	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B38:02	DRFPRPVTV	0.9974	0.9804	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B44:03	KEARIFDRF	0.9953	0.8921	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B15:37	DRFPRPVTV	0.992	0.7072	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B13:01	KEARIFDRF	0.9912	0.7629	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B15:10	DRFPRPVTV	0.9639	0.7129	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-A30:08	RIFDRFPRP	0.9639	0.6965	9	18
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B08:09	DRFPRPVTV	0.9619	0.7525	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B52:01	DRFPRPVTV	0.9563	0.9667	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B15:18	DRFPRPVTV	0.6575	0.872	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B07:10	DRFPRPVTV	0.057	0.6117	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:01	FDRFPRPVTV	0.988	0.9665	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:02	FDRFPRPVTV	0.988	0.9665	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-A30:08	RIFDRFPRPV	0.9869	0.8233	9	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:01	DRFPRPVTVE	0.9845	0.8782	12	22
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:02	DRFPRPVTVE	0.9845	0.8782	12	22
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:04	FDRFPRPVTV	0.9805	0.7828	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:07	FDRFPRPVTV	0.9786	0.6472	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:24	FDRFPRPVTV	0.9245	0.8121	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:06	FDRFPRPVTV	0.9235	0.9665	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-A02:20	RIFDRFPRPV	0.9018	0.5865	9	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B73:01	DRFPRPVT	0.9986	0.8791	12	20
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:14	ARIFDRFPR	0.9996	0.7494	8	17
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B73:01	DRFPRPVTV	0.9993	0.9183	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:14	DRFPRPVTV	0.9989	0.698	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:09	DRFPRPVTV	0.9979	0.9195	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:12	DRFPRPVTV	0.9978	0.9676	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:10	IFDRFPRPV	0.9977	0.6946	10	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:05	DRFPRPVTV	0.9972	0.9631	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:07	IFDRFPRPV	0.9967	0.6931	10	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:05	DRFPRPVTV	0.9812	0.9566	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:03	ARIFDRFPR	0.9762	0.7747	8	17
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:27	DRFPRPVTV	0.9629	0.9623	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B51:07	DRFPRPVTV	0.9403	0.8551	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B14:03	DRFPRPVTV	0.9241	0.896	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:95	DRFPRPVTV	0.871	0.8259	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:46	DRFPRPVTV	0.8692	0.951	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:10	DRFPRPVTV	0.8654	0.979	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:14	IFDRFPRPV	0.8497	0.7633	10	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:19	DRFPRPVTV	0.8469	0.8758	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:80	DRFPRPVTV	0.8389	0.9721	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:67	DRFPRPVTV	0.8389	0.9721	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:29	DRFPRPVTV	0.837	0.9452	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:13	DRFPRPVTV	0.8067	0.9522	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:03	DRFPRPVTV	0.4748	0.9953	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C12:16	DRFPRPVTV	0.2272	0.975	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B73:01	DRFPRPVTVE	0.9929	0.825	12	22
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:14	FDRFPRPVTV	0.9866	0.7785	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B73:01	FDRFPRPVTV	0.9725	0.9599	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:05	FDRFPRPVTV	0.9207	0.9361	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C12:16	FDRFPRPVTV	0.8357	0.9745	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:13	FDRFPRPVTV	0.7625	0.9564	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:95	FDRFPRPVTV	0.7617	0.8174	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:29	FDRFPRPVTV	0.7505	0.9339	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:27	FDRFPRPVTV	0.7252	0.9492	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:46	FDRFPRPVTV	0.7035	0.9515	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:67	FDRFPRPVTV	0.6943	0.9751	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:80	FDRFPRPVTV	0.6943	0.9751	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:12	FDRFPRPVTV	0.6634	0.9754	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:10	FDRFPRPVTV	0.6573	0.9781	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:19	FDRFPRPVTV	0.647	0.8969	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:10	IFDRFPRPVTV	0.9998	0.873	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:07	IFDRFPRPVTV	0.9997	0.868	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B73:01	DRFPRPVTVEP	0.9994	0.8485	12	23
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:14	IFDRFPRPVTV	0.9963	0.8838	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:05	IFDRFPRPVTV	0.9869	0.9445	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:06	DRFPRPVTV	0.9996	0.79	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:09	DRFPRPVTV	0.9995	0.6459	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:10	ARIFDRFPR	0.9994	0.7663	8	17
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:10	DRFPRPVTV	0.9994	0.8138	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:08	DRFPRPVTV	0.9991	0.5862	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C18:01	IFDRFPRPV	0.9984	0.7069	10	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:31	DRFPRPVTV	0.9983	0.9655	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B38:05	DRFPRPVTV	0.9975	0.9796	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:01	IFDRFPRPV	0.9967	0.6931	10	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B44:07	KEARIFDRF	0.9953	0.8921	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B44:26	KEARIFDRF	0.9953	0.8921	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B44:13	KEARIFDRF	0.9953	0.8921	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B40:04	KEARIFDRF	0.9895	0.581	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B08:12	DRFPRPVTV	0.9747	0.6359	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B15:09	DRFPRPVTV	0.9617	0.879	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:08	DRFPRPVTV	0.958	0.9936	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:04	DRFPRPVTV	0.9423	0.9584	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B18:08	KEARIFDRF	0.9421	0.858	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:04	IFDRFPRPV	0.9405	0.7945	10	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:01	DRFPRPVTV	0.9085	0.8145	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B18:11	KEARIFDRF	0.9045	0.8704	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:17	DRFPRPVTV	0.8892	0.9725	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:02	DRFPRPVTV	0.8389	0.9721	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B39:11	DRFPRPVTV	0.8106	0.8787	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C03:67	DRFPRPVTV	0.7047	0.9822	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:22	DRFPRPVTV	0.6858	0.8292	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:06	DRFPRPVTV	0.6052	0.9933	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:17	DRFPRPVTV	0.492	0.9954	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:02	DRFPRPVTV	0.492	0.9954	12	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B48:02	KEARIFDRF	0.1798	0.8629	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B15:53	KEARIFDRF	0.1012	0.7641	6	15
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-A02:03	RIFDRFPRPV	0.9934	0.6981	9	19
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:10	FDRFPRPVTV	0.9837	0.8796	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:08	FDRFPRPVTV	0.9837	0.7079	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:09	FDRFPRPVTV	0.9833	0.7544	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:06	FDRFPRPVTV	0.9788	0.8248	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:17	FDRFPRPVTV	0.976	0.9972	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:02	FDRFPRPVTV	0.976	0.9972	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:06	FDRFPRPVTV	0.9692	0.993	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:08	FDRFPRPVTV	0.9587	0.9952	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:01	FDRFPRPVTV	0.7711	0.814	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:22	FDRFPRPVTV	0.7688	0.8313	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:04	FDRFPRPVTV	0.7441	0.9576	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:02	FDRFPRPVTV	0.6943	0.9751	11	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-B27:06	IFDRFPRPVTV	0.9997	0.7183	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C18:01	IFDRFPRPVTV	0.9997	0.8601	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:01	IFDRFPRPVTV	0.9997	0.868	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:08	IFDRFPRPVTV	0.9973	0.9857	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C04:04	IFDRFPRPVTV	0.9968	0.8701	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:17	IFDRFPRPVTV	0.9931	0.9941	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C06:02	IFDRFPRPVTV	0.9931	0.9941	10	21
OGT-NONO	chrX	70774442	chrX	70516415	875	HLA-C07:04	IFDRFPRPVTV	0.9492	0.9563	10	21

Top

Potential FusionNeoAntigen Information of OGT-NONO in HLA II

OGT-NONO_70774442_70516415.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
OGT-NONO	chrX	70774442	chrX	70516415	875	DRB1-1169	ARIFDRFPRPVTVEP	8	23
OGT-NONO	chrX	70774442	chrX	70516415	875	DRB1-1394	LGNVLKEARIFDRFP	1	16

Top

Fusion breakpoint peptide structures of OGT-NONO

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4175	KEARIFDRFPRPVT	OGT	NONO	chrX	70774442	chrX	70516415	875

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of OGT-NONO

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4175	KEARIFDRFPRPVT	-7.9962	-8.1096
HLA-B14:02	3BVN	4175	KEARIFDRFPRPVT	-5.70842	-6.74372
HLA-B52:01	3W39	4175	KEARIFDRFPRPVT	-6.83737	-6.95077
HLA-B52:01	3W39	4175	KEARIFDRFPRPVT	-4.4836	-5.5189
HLA-A11:01	4UQ2	4175	KEARIFDRFPRPVT	-10.0067	-10.1201
HLA-A11:01	4UQ2	4175	KEARIFDRFPRPVT	-9.03915	-10.0745
HLA-A24:02	5HGA	4175	KEARIFDRFPRPVT	-6.56204	-6.67544
HLA-A24:02	5HGA	4175	KEARIFDRFPRPVT	-5.42271	-6.45801
HLA-B44:05	3DX8	4175	KEARIFDRFPRPVT	-7.85648	-8.89178
HLA-B44:05	3DX8	4175	KEARIFDRFPRPVT	-5.3978	-5.5112
HLA-A02:01	6TDR	4175	KEARIFDRFPRPVT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of OGT-NONO

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
OGT-NONO	chrX	70774442	chrX	70516415	10	19	IFDRFPRPV	TTTTGACAGATTTCCTCGTCCTGTGAC
OGT-NONO	chrX	70774442	chrX	70516415	10	21	IFDRFPRPVTV	TTTTGACAGATTTCCTCGTCCTGTGACTGTGGA
OGT-NONO	chrX	70774442	chrX	70516415	11	21	FDRFPRPVTV	TGACAGATTTCCTCGTCCTGTGACTGTGGA
OGT-NONO	chrX	70774442	chrX	70516415	12	20	DRFPRPVT	CAGATTTCCTCGTCCTGTGACTGT
OGT-NONO	chrX	70774442	chrX	70516415	12	21	DRFPRPVTV	CAGATTTCCTCGTCCTGTGACTGTGGA
OGT-NONO	chrX	70774442	chrX	70516415	12	22	DRFPRPVTVE	CAGATTTCCTCGTCCTGTGACTGTGGAGCC
OGT-NONO	chrX	70774442	chrX	70516415	12	23	DRFPRPVTVEP	CAGATTTCCTCGTCCTGTGACTGTGGAGCCCAT
OGT-NONO	chrX	70774442	chrX	70516415	6	15	KEARIFDRF	AGAGGCACGCATTTTTGACAGATTTCC
OGT-NONO	chrX	70774442	chrX	70516415	8	17	ARIFDRFPR	ACGCATTTTTGACAGATTTCCTCGTCC
OGT-NONO	chrX	70774442	chrX	70516415	9	18	RIFDRFPRP	CATTTTTGACAGATTTCCTCGTCCTGT
OGT-NONO	chrX	70774442	chrX	70516415	9	19	RIFDRFPRPV	CATTTTTGACAGATTTCCTCGTCCTGTGAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
OGT-NONO	chrX	70774442	chrX	70516415	1	16	LGNVLKEARIFDRFP	AGGAAATGTCTTGAAAGAGGCACGCATTTTTGACAGATTTCCTCG
OGT-NONO	chrX	70774442	chrX	70516415	8	23	ARIFDRFPRPVTVEP	ACGCATTTTTGACAGATTTCCTCGTCCTGTGACTGTGGAGCCCAT

Top

Information of the samples that have these potential fusion neoantigens of OGT-NONO

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LIHC	OGT-NONO	chrX	70774442	ENST00000373701	chrX	70516415	ENST00000276079	TCGA-FV-A496-01A

Top

Potential target of CAR-T therapy development for OGT-NONO

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to OGT-NONO

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to OGT-NONO

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)