Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:OSCP1-BMS1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: OSCP1-BMS1
	FusionPDB ID: 61886
	FusionGDB2.0 ID: 61886
		Hgene	Tgene
	Gene symbol	OSCP1	BMS1
	Gene ID	127700	9790
	Gene name	organic solute carrier partner 1	BMS1 ribosome biogenesis factor
	Synonyms	C1orf102\|NOR1	ACC\|BMS1L
	Cytomap	1p34.3	10q11.21
	Type of gene	protein-coding	protein-coding
	Description	protein OSCP1organic solute carrier protein 1organic solute transport protein 1oxidored nitro domain containing proteinoxidored-nitro domain-containing protein 1	ribosome biogenesis protein BMS1 homologBMS1 homolog, ribosome assembly proteinBMS1-like, ribosome assembly proteinribosome assembly protein BMS1 homolog
	Modification date	20200313	20200313
	UniProtAcc	.	Q14692 Main function of 5'-partner protein: FUNCTION: May act as a molecular switch during maturation of the 40S ribosomal subunit in the nucleolus. {ECO:0000250\|UniProtKB:Q08965}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000235532, ENST00000356637, ENST00000433045, ENST00000315643, ENST00000354267, ENST00000495222,	ENST00000374518,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 6 X 3=90	6 X 6 X 3=108
	# samples	6	6
	** MAII score	log2(6/90*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/108*10)=-0.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: OSCP1 [Title/Abstract] AND BMS1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: OSCP1 [Title/Abstract] AND BMS1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	OSCP1(36884591)-BMS1(43287073), # samples:1
Anticipated loss of major functional domain due to fusion event.	OSCP1-BMS1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. OSCP1-BMS1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. OSCP1-BMS1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. OSCP1-BMS1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:36884591/chr10:43287073)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across OSCP1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BMS1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000235532	OSCP1	chr1	36884591	-	ENST00000374518	BMS1	chr10	43287073	+	8159	1105	1	4317	1438
ENST00000356637	OSCP1	chr1	36884591	-	ENST00000374518	BMS1	chr10	43287073	+	8171	1117	13	4329	1438
ENST00000433045	OSCP1	chr1	36884591	-	ENST00000374518	BMS1	chr10	43287073	+	8122	1068	120	4280	1386

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000235532	ENST00000374518	OSCP1	chr1	36884591	-	BMS1	chr10	43287073	+	0.000479396	0.99952066
ENST00000356637	ENST00000374518	OSCP1	chr1	36884591	-	BMS1	chr10	43287073	+	0.000469265	0.9995308
ENST00000433045	ENST00000374518	OSCP1	chr1	36884591	-	BMS1	chr10	43287073	+	0.000522338	0.9994777

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for OSCP1-BMS1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
OSCP1	chr1	36884591	BMS1	chr10	43287073	1068	316	ELSYEVINIQATQGAKLFYLSGMVHG
OSCP1	chr1	36884591	BMS1	chr10	43287073	1105	368	ELSYEVINIQATQGAKLFYLSGMVHG
OSCP1	chr1	36884591	BMS1	chr10	43287073	1117	368	ELSYEVINIQATQGAKLFYLSGMVHG

Top

Potential FusionNeoAntigen Information of OSCP1-BMS1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

OSCP1-BMS1_36884591_43287073.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:17	ATQGAKLFY	0.9867	0.9743	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:16	ATQGAKLFY	0.9455	0.9649	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-A80:01	ATQGAKLFY	0.9355	0.5033	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B58:02	ATQGAKLFY	0.9036	0.967	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-A30:08	ATQGAKLFY	0.6545	0.8281	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:03	IQATQGAKL	0.5233	0.7029	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B39:13	IQATQGAKL	0.4895	0.8851	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-A32:13	ATQGAKLFY	0.4279	0.95	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B13:02	IQATQGAKL	0.3741	0.6048	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B13:01	IQATQGAKL	0.3482	0.9637	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B52:01	IQATQGAKL	0.0364	0.9516	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:01	IQATQGAKLF	0.9998	0.7036	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:03	IQATQGAKLF	0.9815	0.6342	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:01	IQATQGAKLFY	0.9999	0.6044	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:25	IQATQGAKLFY	0.9917	0.754	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:04	IQATQGAKL	0.908	0.7471	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C15:04	ATQGAKLFY	0.8884	0.9395	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B39:08	IQATQGAKL	0.524	0.8865	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C12:12	QATQGAKLF	0.4758	0.9436	9	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C03:14	ATQGAKLFY	0.1418	0.9776	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:05	IQATQGAKLFY	0.9812	0.7158	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:50	IQATQGAKL	0.977	0.8204	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C03:02	QATQGAKLF	0.9749	0.9712	9	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B57:04	ATQGAKLFY	0.9664	0.8807	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B58:06	ATQGAKLFY	0.9565	0.9497	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C15:09	ATQGAKLFY	0.8884	0.9395	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:73	IQATQGAKL	0.8629	0.8889	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:53	IQATQGAKL	0.8343	0.716	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:54	IQATQGAKL	0.8015	0.6882	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:30	IQATQGAKL	0.7718	0.775	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B39:02	IQATQGAKL	0.6322	0.8905	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C16:01	QATQGAKLF	0.4628	0.9722	9	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C16:01	ATQGAKLFY	0.3056	0.974	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C16:02	QATQGAKLF	0.246	0.9895	9	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C16:02	ATQGAKLFY	0.1806	0.9892	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:09	IQATQGAKL	0.1493	0.7573	8	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C02:02	ATQGAKLFY	0.0069	0.9712	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-C02:10	ATQGAKLFY	0.0069	0.9712	10	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:34	IQATQGAKLF	0.9998	0.7036	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:27	IQATQGAKLF	0.9998	0.7394	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:33	IQATQGAKLF	0.9998	0.7036	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:125	IQATQGAKLF	0.9998	0.7036	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:24	IQATQGAKLF	0.9998	0.7697	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:135	IQATQGAKLF	0.9998	0.7121	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:50	IQATQGAKLF	0.9997	0.8056	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:53	IQATQGAKLF	0.9996	0.6549	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:54	IQATQGAKLF	0.9988	0.6163	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:12	IQATQGAKLF	0.9912	0.8323	8	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:50	IQATQGAKLFY	0.9999	0.6722	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:27	IQATQGAKLFY	0.9999	0.664	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:33	IQATQGAKLFY	0.9999	0.6044	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:135	IQATQGAKLFY	0.9999	0.61	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:34	IQATQGAKLFY	0.9999	0.6044	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:125	IQATQGAKLFY	0.9999	0.6044	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:12	IQATQGAKLFY	0.9997	0.7155	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:53	IQATQGAKLFY	0.9994	0.5632	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:35	IQATQGAKLFY	0.9993	0.5544	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:54	IQATQGAKLFY	0.9981	0.5292	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:39	IQATQGAKLFY	0.99	0.6127	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-A68:02	EVINIQATQGA	0.9892	0.7529	4	15
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B15:20	IQATQGAKLFY	0.9843	0.8159	8	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	HLA-B35:28	IQATQGAKLFY	0.9759	0.8461	8	19

Top

Potential FusionNeoAntigen Information of OSCP1-BMS1 in HLA II

OSCP1-BMS1_36884591_43287073.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0413	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0413	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0413	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0415	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0415	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0427	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0427	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0436	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0436	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0437	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0437	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0437	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0440	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0440	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0440	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0442	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0442	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0442	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0444	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0444	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0444	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0450	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0451	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0451	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0453	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0453	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0453	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0455	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0455	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0455	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0456	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0456	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0456	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0458	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0458	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0468	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0468	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0468	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0470	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0470	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0470	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0473	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0473	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0473	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0478	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0479	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0479	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0479	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0701	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0701	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0701	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0703	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0703	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0703	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0704	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0704	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0704	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0705	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0705	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0705	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0706	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0706	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0707	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0707	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0707	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0708	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0708	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0708	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0709	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0709	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0709	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0711	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0711	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0711	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0712	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0712	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0712	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0713	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0713	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0713	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0714	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0714	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0714	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0715	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0715	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0715	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0716	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0716	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0716	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0717	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0717	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0717	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0719	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0719	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-0719	VINIQATQGAKLFYL	5	20
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-1002	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB1-1002	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0101	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0101	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0101	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0101	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0103	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0103	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0103	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0103	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0104	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0104	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0104	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0104	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0106	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0106	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0106	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0106	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0107	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0107	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0107	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0107	EVINIQATQGAKLFY	4	19
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0108	SYEVINIQATQGAKL	2	17
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0108	LSYEVINIQATQGAK	1	16
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0108	YEVINIQATQGAKLF	3	18
OSCP1-BMS1	chr1	36884591	chr10	43287073	1105	DRB4-0108	EVINIQATQGAKLFY	4	19

Top

Fusion breakpoint peptide structures of OSCP1-BMS1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3855	INIQATQGAKLFYL	OSCP1	BMS1	chr1	36884591	chr10	43287073	1105

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of OSCP1-BMS1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3855	INIQATQGAKLFYL	-7.15543	-7.26883
HLA-B14:02	3BVN	3855	INIQATQGAKLFYL	-4.77435	-5.80965
HLA-B52:01	3W39	3855	INIQATQGAKLFYL	-6.80875	-6.92215
HLA-B52:01	3W39	3855	INIQATQGAKLFYL	-4.20386	-5.23916
HLA-A11:01	4UQ2	3855	INIQATQGAKLFYL	-7.5194	-8.5547
HLA-A11:01	4UQ2	3855	INIQATQGAKLFYL	-6.9601	-7.0735
HLA-A24:02	5HGA	3855	INIQATQGAKLFYL	-7.52403	-7.63743
HLA-A24:02	5HGA	3855	INIQATQGAKLFYL	-5.82433	-6.85963
HLA-B27:05	6PYJ	3855	INIQATQGAKLFYL	-3.28285	-4.31815
HLA-B44:05	3DX8	3855	INIQATQGAKLFYL	-5.91172	-6.94702
HLA-B44:05	3DX8	3855	INIQATQGAKLFYL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of OSCP1-BMS1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
OSCP1-BMS1	chr1	36884591	chr10	43287073	10	19	ATQGAKLFY	GCCACCCAGGGTGCCAAGCTGTTCTAC
OSCP1-BMS1	chr1	36884591	chr10	43287073	4	15	EVINIQATQGA	GAAGTTATCAACATACAAGCCACCCAGGGTGCC
OSCP1-BMS1	chr1	36884591	chr10	43287073	8	17	IQATQGAKL	ATACAAGCCACCCAGGGTGCCAAGCTG
OSCP1-BMS1	chr1	36884591	chr10	43287073	8	18	IQATQGAKLF	ATACAAGCCACCCAGGGTGCCAAGCTGTTC
OSCP1-BMS1	chr1	36884591	chr10	43287073	8	19	IQATQGAKLFY	ATACAAGCCACCCAGGGTGCCAAGCTGTTCTAC
OSCP1-BMS1	chr1	36884591	chr10	43287073	9	18	QATQGAKLF	CAAGCCACCCAGGGTGCCAAGCTGTTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
OSCP1-BMS1	chr1	36884591	chr10	43287073	1	16	LSYEVINIQATQGAK	TTATCCTATGAAGTTATCAACATACAAGCCACCCAGGGTGCCAAG
OSCP1-BMS1	chr1	36884591	chr10	43287073	2	17	SYEVINIQATQGAKL	TCCTATGAAGTTATCAACATACAAGCCACCCAGGGTGCCAAGCTG
OSCP1-BMS1	chr1	36884591	chr10	43287073	3	18	YEVINIQATQGAKLF	TATGAAGTTATCAACATACAAGCCACCCAGGGTGCCAAGCTGTTC
OSCP1-BMS1	chr1	36884591	chr10	43287073	4	19	EVINIQATQGAKLFY	GAAGTTATCAACATACAAGCCACCCAGGGTGCCAAGCTGTTCTAC
OSCP1-BMS1	chr1	36884591	chr10	43287073	5	20	VINIQATQGAKLFYL	GTTATCAACATACAAGCCACCCAGGGTGCCAAGCTGTTCTACCTT

Top

Information of the samples that have these potential fusion neoantigens of OSCP1-BMS1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	OSCP1-BMS1	chr1	36884591	ENST00000235532	chr10	43287073	ENST00000374518	DB080871

Top

Potential target of CAR-T therapy development for OSCP1-BMS1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to OSCP1-BMS1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to OSCP1-BMS1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)