Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PBX1-ILDR2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PBX1-ILDR2
	FusionPDB ID: 63024
	FusionGDB2.0 ID: 63024
		Hgene	Tgene
	Gene symbol	PBX1	ILDR2
	Gene ID	5087	387597
	Gene name	PBX homeobox 1	immunoglobulin like domain containing receptor 2
	Synonyms	CAKUHED	C1orf32\|dJ782G3.1
	Cytomap	1q23.3	1q24.1
	Type of gene	protein-coding	protein-coding
	Description	pre-B-cell leukemia transcription factor 1homeobox protein PBX1homeobox protein PRLpre-B-cell leukemia homeobox 1	immunoglobulin-like domain-containing receptor 2
	Modification date	20200313	20200313
	UniProtAcc	P40424 Main function of 5'-partner protein: FUNCTION: Transcription factor which binds the DNA sequence 5'-TGATTGAT-3' as part of a heterodimer with HOX proteins such as HOXA1, HOXA5, HOXB7 and HOXB8 (PubMed:9191052). Binds to the DNA sequence 5'-TGATTGAC-3' in complex with a nuclear factor which is not a class I HOX protein (PubMed:9191052). Has also been shown to bind the DNA sequence 5'-ATCAATCAA-3' cooperatively with HOXA5, HOXB7, HOXB8, HOXC8 and HOXD4 (PubMed:8327485, PubMed:7791786). Acts as a transcriptional activator of PF4 in complex with MEIS1 (PubMed:12609849). Also activates transcription of SOX3 in complex with MEIS1 by binding to the 5'-TGATTGAC-3' consensus sequence (By similarity). In natural killer cells, binds to the NFIL3 promoter and acts as a transcriptional activator of NFIL3, promoting natural killer cell development (By similarity). Plays a role in the cAMP-dependent regulation of CYP17A1 gene expression via its cAMP-regulatory sequence (CRS1) (By similarity). Probably in complex with MEIS2, involved in transcriptional regulation by KLF4 (PubMed:21746878). Acts as a transcriptional activator of NKX2-5 and a transcriptional repressor of CDKN2B (By similarity). Together with NKX2-5, required for spleen development through a mechanism that involves CDKN2B repression (By similarity). {ECO:0000250\|UniProtKB:P41778, ECO:0000269\|PubMed:12609849, ECO:0000269\|PubMed:21746878, ECO:0000269\|PubMed:7791786, ECO:0000269\|PubMed:8327485, ECO:0000269\|PubMed:9191052}.; FUNCTION: [Isoform PBX1b]: As part of a PDX1:PBX1b:MEIS2B complex in pancreatic acinar cells, is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. {ECO:0000250\|UniProtKB:P41778}.	Q71H61 Main function of 5'-partner protein: FUNCTION: May be involved in lipid homeostasis and ER stress pathways. {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000367897, ENST00000401534, ENST00000420696, ENST00000540236, ENST00000559240, ENST00000474046, ENST00000485769, ENST00000540246, ENST00000560641,	ENST00000271417, ENST00000469934, ENST00000525740, ENST00000526687, ENST00000528703, ENST00000529071, ENST00000529387,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	16 X 10 X 5=800	6 X 6 X 4=144
	# samples	21	6
	** MAII score	log2(21/800*10)=-1.9296106721086 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/144*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PBX1 [Title/Abstract] AND ILDR2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PBX1 [Title/Abstract] AND ILDR2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PBX1(164532548)-ILDR2(166927338), # samples:3
Anticipated loss of major functional domain due to fusion event.	PBX1-ILDR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PBX1-ILDR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PBX1-ILDR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PBX1-ILDR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:164532548/chr1:166927338)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PBX1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ILDR2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000420696	PBX1	chr1	164532548	+	ENST00000271417	ILDR2	chr1	166927338	-	8476	453	182	2326	714
ENST00000420696	PBX1	chr1	164532548	+	ENST00000529387	ILDR2	chr1	166927338	-	1431	453	182	910	242
ENST00000420696	PBX1	chr1	164532548	+	ENST00000528703	ILDR2	chr1	166927338	-	2639	453	182	2149	655
ENST00000420696	PBX1	chr1	164532548	+	ENST00000526687	ILDR2	chr1	166927338	-	2492	453	182	2002	606
ENST00000420696	PBX1	chr1	164532548	+	ENST00000469934	ILDR2	chr1	166927338	-	2143	453	182	1720	512
ENST00000420696	PBX1	chr1	164532548	+	ENST00000525740	ILDR2	chr1	166927338	-	2435	453	182	1945	587
ENST00000420696	PBX1	chr1	164532548	+	ENST00000529071	ILDR2	chr1	166927338	-	2759	453	182	2269	695
ENST00000401534	PBX1	chr1	164532548	+	ENST00000271417	ILDR2	chr1	166927338	-	8288	265	0	2138	712
ENST00000401534	PBX1	chr1	164532548	+	ENST00000529387	ILDR2	chr1	166927338	-	1243	265	0	722	240
ENST00000401534	PBX1	chr1	164532548	+	ENST00000528703	ILDR2	chr1	166927338	-	2451	265	0	1961	653
ENST00000401534	PBX1	chr1	164532548	+	ENST00000526687	ILDR2	chr1	166927338	-	2304	265	0	1814	604
ENST00000401534	PBX1	chr1	164532548	+	ENST00000469934	ILDR2	chr1	166927338	-	1955	265	0	1532	510
ENST00000401534	PBX1	chr1	164532548	+	ENST00000525740	ILDR2	chr1	166927338	-	2247	265	0	1757	585
ENST00000401534	PBX1	chr1	164532548	+	ENST00000529071	ILDR2	chr1	166927338	-	2571	265	0	2081	693
ENST00000559240	PBX1	chr1	164532548	+	ENST00000271417	ILDR2	chr1	166927338	-	8288	265	0	2138	712
ENST00000559240	PBX1	chr1	164532548	+	ENST00000529387	ILDR2	chr1	166927338	-	1243	265	0	722	240
ENST00000559240	PBX1	chr1	164532548	+	ENST00000528703	ILDR2	chr1	166927338	-	2451	265	0	1961	653
ENST00000559240	PBX1	chr1	164532548	+	ENST00000526687	ILDR2	chr1	166927338	-	2304	265	0	1814	604
ENST00000559240	PBX1	chr1	164532548	+	ENST00000469934	ILDR2	chr1	166927338	-	1955	265	0	1532	510
ENST00000559240	PBX1	chr1	164532548	+	ENST00000525740	ILDR2	chr1	166927338	-	2247	265	0	1757	585
ENST00000559240	PBX1	chr1	164532548	+	ENST00000529071	ILDR2	chr1	166927338	-	2571	265	0	2081	693
ENST00000367897	PBX1	chr1	164532548	+	ENST00000271417	ILDR2	chr1	166927338	-	8288	265	0	2138	712
ENST00000367897	PBX1	chr1	164532548	+	ENST00000529387	ILDR2	chr1	166927338	-	1243	265	0	722	240
ENST00000367897	PBX1	chr1	164532548	+	ENST00000528703	ILDR2	chr1	166927338	-	2451	265	0	1961	653
ENST00000367897	PBX1	chr1	164532548	+	ENST00000526687	ILDR2	chr1	166927338	-	2304	265	0	1814	604
ENST00000367897	PBX1	chr1	164532548	+	ENST00000469934	ILDR2	chr1	166927338	-	1955	265	0	1532	510
ENST00000367897	PBX1	chr1	164532548	+	ENST00000525740	ILDR2	chr1	166927338	-	2247	265	0	1757	585
ENST00000367897	PBX1	chr1	164532548	+	ENST00000529071	ILDR2	chr1	166927338	-	2571	265	0	2081	693
ENST00000540236	PBX1	chr1	164532548	+	ENST00000271417	ILDR2	chr1	166927338	-	8288	265	0	2138	712
ENST00000540236	PBX1	chr1	164532548	+	ENST00000529387	ILDR2	chr1	166927338	-	1243	265	0	722	240
ENST00000540236	PBX1	chr1	164532548	+	ENST00000528703	ILDR2	chr1	166927338	-	2451	265	0	1961	653
ENST00000540236	PBX1	chr1	164532548	+	ENST00000526687	ILDR2	chr1	166927338	-	2304	265	0	1814	604
ENST00000540236	PBX1	chr1	164532548	+	ENST00000469934	ILDR2	chr1	166927338	-	1955	265	0	1532	510
ENST00000540236	PBX1	chr1	164532548	+	ENST00000525740	ILDR2	chr1	166927338	-	2247	265	0	1757	585
ENST00000540236	PBX1	chr1	164532548	+	ENST00000529071	ILDR2	chr1	166927338	-	2571	265	0	2081	693

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000420696	ENST00000271417	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.003037883	0.99696213
ENST00000420696	ENST00000529387	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.006635113	0.99336493
ENST00000420696	ENST00000528703	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.016656157	0.9833438
ENST00000420696	ENST00000526687	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.011026671	0.9889733
ENST00000420696	ENST00000469934	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.00962884	0.99037117
ENST00000420696	ENST00000525740	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.00943883	0.9905612
ENST00000420696	ENST00000529071	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.015346006	0.984654
ENST00000401534	ENST00000271417	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.00300899	0.99699104
ENST00000401534	ENST00000529387	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.004591653	0.99540836
ENST00000401534	ENST00000528703	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.018866118	0.9811338
ENST00000401534	ENST00000526687	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.012301314	0.9876987
ENST00000401534	ENST00000469934	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.009867968	0.990132
ENST00000401534	ENST00000525740	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.010895522	0.9891045
ENST00000401534	ENST00000529071	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.017254258	0.98274577
ENST00000559240	ENST00000271417	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.00300899	0.99699104
ENST00000559240	ENST00000529387	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.004591653	0.99540836
ENST00000559240	ENST00000528703	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.018866118	0.9811338
ENST00000559240	ENST00000526687	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.012301314	0.9876987
ENST00000559240	ENST00000469934	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.009867968	0.990132
ENST00000559240	ENST00000525740	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.010895522	0.9891045
ENST00000559240	ENST00000529071	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.017254258	0.98274577
ENST00000367897	ENST00000271417	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.00300899	0.99699104
ENST00000367897	ENST00000529387	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.004591653	0.99540836
ENST00000367897	ENST00000528703	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.018866118	0.9811338
ENST00000367897	ENST00000526687	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.012301314	0.9876987
ENST00000367897	ENST00000469934	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.009867968	0.990132
ENST00000367897	ENST00000525740	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.010895522	0.9891045
ENST00000367897	ENST00000529071	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.017254258	0.98274577
ENST00000540236	ENST00000271417	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.00300899	0.99699104
ENST00000540236	ENST00000529387	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.004591653	0.99540836
ENST00000540236	ENST00000528703	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.018866118	0.9811338
ENST00000540236	ENST00000526687	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.012301314	0.9876987
ENST00000540236	ENST00000469934	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.009867968	0.990132
ENST00000540236	ENST00000525740	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.010895522	0.9891045
ENST00000540236	ENST00000529071	PBX1	chr1	164532548	+	ILDR2	chr1	166927338	-	0.017254258	0.98274577

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PBX1-ILDR2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PBX1	chr1	164532548	ILDR2	chr1	166927338	265	88	ALFNVLCEIKEKTAMVEGLQVTVPDK
PBX1	chr1	164532548	ILDR2	chr1	166927338	453	90	ALFNVLCEIKEKTAMVEGLQVTVPDK

Top

Potential FusionNeoAntigen Information of PBX1-ILDR2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PBX1-ILDR2_164532548_166927338.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B08:09	EIKEKTAM	0.9995	0.6632	7	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B08:09	EIKEKTAMV	0.9974	0.6902	7	16
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:02	TAMVEGLQV	0.9928	0.857	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:01	TAMVEGLQV	0.9901	0.8391	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B18:01	CEIKEKTAM	0.9832	0.9527	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B52:01	TAMVEGLQV	0.9798	0.992	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B39:13	CEIKEKTAM	0.5602	0.9091	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B78:01	TAMVEGLQV	0.99	0.8618	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-C03:19	TAMVEGLQV	0.9898	0.9908	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:07	TAMVEGLQV	0.987	0.9898	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:08	TAMVEGLQV	0.9468	0.7189	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-C02:06	TAMVEGLQV	0.9334	0.9692	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B08:12	EIKEKTAM	0.9906	0.6535	7	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-C15:02	TAMVEGLQV	0.9991	0.9054	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-C15:05	TAMVEGLQV	0.9986	0.9459	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B40:04	CEIKEKTAM	0.9972	0.6092	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:13	TAMVEGLQV	0.9902	0.6263	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B78:02	TAMVEGLQV	0.99	0.853	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:09	TAMVEGLQV	0.9893	0.7389	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:14	TAMVEGLQV	0.9873	0.8108	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B18:08	CEIKEKTAM	0.9862	0.936	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B18:04	CEIKEKTAM	0.9861	0.9566	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B18:05	CEIKEKTAM	0.9832	0.9527	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B18:06	CEIKEKTAM	0.9814	0.9587	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:21	TAMVEGLQV	0.98	0.7874	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-A68:02	EIKEKTAMV	0.9526	0.5297	7	16
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B18:03	CEIKEKTAM	0.9439	0.9475	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B18:11	CEIKEKTAM	0.9275	0.8944	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B51:29	TAMVEGLQV	0.9162	0.5699	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-C03:06	TAMVEGLQV	0.8833	0.9893	12	21
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B08:12	EIKEKTAMV	0.815	0.6494	7	16
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-A25:01	EIKEKTAMV	0.8014	0.8872	7	16
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-A69:01	EIKEKTAMV	0.7867	0.5867	7	16
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B48:02	CEIKEKTAM	0.6925	0.8671	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B41:03	CEIKEKTAM	0.6286	0.5101	6	15
PBX1-ILDR2	chr1	164532548	chr1	166927338	265	HLA-B15:53	CEIKEKTAM	0.4644	0.826	6	15

Top

Potential FusionNeoAntigen Information of PBX1-ILDR2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PBX1-ILDR2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
796	CEIKEKTAMVEGLQ	PBX1	ILDR2	chr1	164532548	chr1	166927338	265

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PBX1-ILDR2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	796	CEIKEKTAMVEGLQ	-6.11479	-7.15009
HLA-B14:02	3BVN	796	CEIKEKTAMVEGLQ	-4.76706	-4.88046
HLA-B52:01	3W39	796	CEIKEKTAMVEGLQ	-6.87405	-6.98745
HLA-B52:01	3W39	796	CEIKEKTAMVEGLQ	-5.3619	-6.3972
HLA-A11:01	4UQ2	796	CEIKEKTAMVEGLQ	-9.79836	-9.91176
HLA-A24:02	5HGA	796	CEIKEKTAMVEGLQ	-8.83847	-8.95187
HLA-A24:02	5HGA	796	CEIKEKTAMVEGLQ	-8.05027	-9.08557
HLA-B44:05	3DX8	796	CEIKEKTAMVEGLQ	-7.51915	-7.63255
HLA-B44:05	3DX8	796	CEIKEKTAMVEGLQ	-4.45384	-5.48914
HLA-A02:01	6TDR	796	CEIKEKTAMVEGLQ	-2.8902	-3.9255

Top

Vaccine Design for the FusionNeoAntigens of PBX1-ILDR2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PBX1-ILDR2	chr1	164532548	chr1	166927338	12	21	TAMVEGLQV	CAGCCATGGTCGAAGGCCTTCAGGTCA
PBX1-ILDR2	chr1	164532548	chr1	166927338	6	15	CEIKEKTAM	GTGAAATCAAAGAAAAAACAGCCATGG
PBX1-ILDR2	chr1	164532548	chr1	166927338	7	15	EIKEKTAM	AAATCAAAGAAAAAACAGCCATGG
PBX1-ILDR2	chr1	164532548	chr1	166927338	7	16	EIKEKTAMV	AAATCAAAGAAAAAACAGCCATGGTCG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PBX1-ILDR2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	PBX1-ILDR2	chr1	164532548	ENST00000367897	chr1	166927338	ENST00000271417	TCGA-A2-A0YM-01A

Top

Potential target of CAR-T therapy development for PBX1-ILDR2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

ILDR2

chr1:164532548

chr1:166927338

ENST00000271417

187_207

640.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PBX1-ILDR2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PBX1-ILDR2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	PBX1	C0006413	Burkitt Lymphoma	2	CTD_human;ORPHANET
Hgene	PBX1	C0343640	African Burkitt's lymphoma	2	CTD_human
Hgene	PBX1	C1968949	Cakut	2	GENOMICS_ENGLAND
Hgene	PBX1	C4721444	Burkitt Leukemia	2	CTD_human
Hgene	PBX1	C0013146	Drug abuse	1	CTD_human
Hgene	PBX1	C0013170	Drug habituation	1	CTD_human
Hgene	PBX1	C0013222	Drug Use Disorders	1	CTD_human
Hgene	PBX1	C0029231	Organic Mental Disorders, Substance-Induced	1	CTD_human
Hgene	PBX1	C0038580	Substance Dependence	1	CTD_human
Hgene	PBX1	C0038586	Substance Use Disorders	1	CTD_human
Hgene	PBX1	C0236969	Substance-Related Disorders	1	CTD_human
Hgene	PBX1	C0431692	Bilateral renal hypoplasia	1	ORPHANET
Hgene	PBX1	C0740858	Substance abuse problem	1	CTD_human
Hgene	PBX1	C1510472	Drug Dependence	1	CTD_human
Hgene	PBX1	C4316881	Prescription Drug Abuse	1	CTD_human
Hgene	PBX1	C4539968	CONGENITAL ANOMALIES OF KIDNEY AND URINARY TRACT SYNDROME WITH OR WITHOUT HEARING LOSS, ABNORMAL EARS, OR DEVELOPMENTAL DELAY	1	GENOMICS_ENGLAND

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)