Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PDE4D-DEPDC1B

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PDE4D-DEPDC1B
	FusionPDB ID: 63720
	FusionGDB2.0 ID: 63720
		Hgene	Tgene
	Gene symbol	PDE4D	DEPDC1B
	Gene ID	5144	55789
	Gene name	phosphodiesterase 4D	DEP domain containing 1B
	Synonyms	ACRDYS2\|DPDE3\|HSPDE4D\|PDE43\|PDE4DN2\|STRK1	BRCC3\|XTP1
	Cytomap	5q11.2-q12.1	5q12.1
	Type of gene	protein-coding	protein-coding
	Description	cAMP-specific 3',5'-cyclic phosphodiesterase 4DcAMP-specific phosphodiesterase PDE4D6phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)testicular tissue protein Li 136	DEP domain-containing protein 1BHBV X-transactivated gene 8 proteinHBV XAg-transactivated protein 8HBxAg transactivated protein 1breast cancer cell 3
	Modification date	20200313	20200313
	UniProtAcc	.	Q8WUY9 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000502484, ENST00000502575, ENST00000507116, ENST00000546160, ENST00000317118, ENST00000340635, ENST00000358923, ENST00000360047, ENST00000405755, ENST00000503258, ENST00000503947,	ENST00000545085, ENST00000509006, ENST00000265036, ENST00000453022,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	40 X 32 X 12=15360	3 X 6 X 6=108
	# samples	56	11
	** MAII score	log2(56/15360*10)=-4.77760757866355 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/108*10)=0.0264722113611909 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: PDE4D [Title/Abstract] AND DEPDC1B [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PDE4D [Title/Abstract] AND DEPDC1B [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PDE4D(59783769)-DEPDC1B(59943360), # samples:6 DEPDC1B(59938638)-PDE4D(59481514), # samples:1 DEPDC1B(59938639)-PDE4D(59481514), # samples:1 DEPDC1B(59982789)-PDE4D(59481514), # samples:1 DEPDC1B(59982789)-PDE4D(59284544), # samples:1
Anticipated loss of major functional domain due to fusion event.	PDE4D-DEPDC1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PDE4D-DEPDC1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PDE4D-DEPDC1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PDE4D-DEPDC1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PDE4D-DEPDC1B seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. PDE4D-DEPDC1B seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. PDE4D-DEPDC1B seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:59783769/chr5:59943360)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PDE4D (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across DEPDC1B (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000502484	PDE4D	chr5	59481383	-	ENST00000265036	DEPDC1B	chr5	59943360	-	2383	266	285	1541	418
ENST00000502484	PDE4D	chr5	59481383	-	ENST00000453022	DEPDC1B	chr5	59943360	-	1480	266	285	1355	356
ENST00000502484	PDE4D	chr5	59481383	-	ENST00000545085	DEPDC1B	chr5	59943360	-	1441	266	285	1355	356
ENST00000507116	PDE4D	chr5	59064073	-	ENST00000265036	DEPDC1B	chr5	59983054	-	2782	399	396	1940	514
ENST00000507116	PDE4D	chr5	59064073	-	ENST00000453022	DEPDC1B	chr5	59983054	-	1879	399	396	1754	452
ENST00000502575	PDE4D	chr5	59064073	-	ENST00000265036	DEPDC1B	chr5	59983054	-	2773	390	387	1931	514
ENST00000502575	PDE4D	chr5	59064073	-	ENST00000453022	DEPDC1B	chr5	59983054	-	1870	390	387	1745	452
ENST00000502484	PDE4D	chr5	59481384	-	ENST00000265036	DEPDC1B	chr5	59943360	-	2383	266	285	1541	418
ENST00000502484	PDE4D	chr5	59481384	-	ENST00000453022	DEPDC1B	chr5	59943360	-	1480	266	285	1355	356
ENST00000502484	PDE4D	chr5	59481384	-	ENST00000545085	DEPDC1B	chr5	59943360	-	1441	266	285	1355	356
ENST00000546160	PDE4D	chr5	59481384	-	ENST00000265036	DEPDC1B	chr5	59983054	-	2425	42	0	1583	527
ENST00000546160	PDE4D	chr5	59481384	-	ENST00000453022	DEPDC1B	chr5	59983054	-	1522	42	0	1397	465

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000502484	ENST00000265036	PDE4D	chr5	59481383	-	DEPDC1B	chr5	59943360	-	0.000169414	0.9998306
ENST00000502484	ENST00000453022	PDE4D	chr5	59481383	-	DEPDC1B	chr5	59943360	-	0.000610035	0.99939
ENST00000502484	ENST00000545085	PDE4D	chr5	59481383	-	DEPDC1B	chr5	59943360	-	0.000588777	0.9994112
ENST00000507116	ENST00000265036	PDE4D	chr5	59064073	-	DEPDC1B	chr5	59983054	-	0.000322847	0.9996772
ENST00000507116	ENST00000453022	PDE4D	chr5	59064073	-	DEPDC1B	chr5	59983054	-	0.002092173	0.9979079
ENST00000502575	ENST00000265036	PDE4D	chr5	59064073	-	DEPDC1B	chr5	59983054	-	0.000316418	0.9996836
ENST00000502575	ENST00000453022	PDE4D	chr5	59064073	-	DEPDC1B	chr5	59983054	-	0.00207231	0.99792767
ENST00000502484	ENST00000265036	PDE4D	chr5	59481384	-	DEPDC1B	chr5	59943360	-	0.000169414	0.9998306
ENST00000502484	ENST00000453022	PDE4D	chr5	59481384	-	DEPDC1B	chr5	59943360	-	0.000610035	0.99939
ENST00000502484	ENST00000545085	PDE4D	chr5	59481384	-	DEPDC1B	chr5	59943360	-	0.000588777	0.9994112
ENST00000546160	ENST00000265036	PDE4D	chr5	59481384	-	DEPDC1B	chr5	59983054	-	0.000174818	0.9998252
ENST00000546160	ENST00000453022	PDE4D	chr5	59481384	-	DEPDC1B	chr5	59983054	-	0.000903731	0.9990963

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PDE4D-DEPDC1B

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PDE4D	chr5	59481384	DEPDC1B	chr5	59983054	42	14	KRNTCDLLSRSKSWNETVELFRAKMP

Top

Potential FusionNeoAntigen Information of PDE4D-DEPDC1B in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PDE4D-DEPDC1B_59481384_59983054.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A30:08	RSKSWNETV	0.9978	0.8516	9	18
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B15:17	KSWNETVEL	0.9976	0.9746	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B15:16	KSWNETVEL	0.9971	0.9175	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B58:02	KSWNETVEL	0.9965	0.9801	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B58:01	KSWNETVEL	0.9965	0.9754	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B57:03	KSWNETVEL	0.9943	0.9953	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A02:21	KSWNETVEL	0.9053	0.8571	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A32:13	KSWNETVEL	0.8806	0.966	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A24:14	SWNETVELF	0.8638	0.542	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B15:16	RSKSWNETV	0.8559	0.9547	9	18
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A02:20	KSWNETVEL	0.7998	0.7789	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B13:02	RSKSWNETV	0.3817	0.9016	9	18
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B13:01	KSWNETVEL	0.2957	0.9637	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B57:01	KSWNETVELF	0.9999	0.9887	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B57:03	KSWNETVELF	0.9997	0.9934	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B58:02	KSWNETVELF	0.9996	0.9748	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B58:01	KSWNETVELF	0.999	0.9726	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B15:17	KSWNETVELF	0.9988	0.9629	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B15:16	KSWNETVELF	0.9986	0.8928	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A32:13	KSWNETVELF	0.9779	0.9627	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:07	SWNETVEL	0.9943	0.9558	12	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:10	SWNETVEL	0.9941	0.9635	12	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:14	SWNETVEL	0.894	0.9621	12	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:07	KSWNETVEL	0.9997	0.9939	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C15:04	KSWNETVEL	0.9997	0.9621	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C15:06	KSWNETVEL	0.9996	0.9596	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:19	KSWNETVEL	0.9996	0.9967	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:08	KSWNETVEL	0.9992	0.9687	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C15:06	RSKSWNETV	0.999	0.9236	9	18
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:06	KSWNETVEL	0.998	0.9635	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:14	KSWNETVEL	0.989	0.9918	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C08:13	KSWNETVEL	0.9873	0.9871	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C08:04	KSWNETVEL	0.9873	0.9871	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C06:03	KSWNETVEL	0.9869	0.9961	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C12:04	KSWNETVEL	0.9857	0.9971	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C08:03	KSWNETVEL	0.9135	0.9935	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C02:06	KSWNETVEL	0.8458	0.9874	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B15:21	SWNETVELF	0.7716	0.9599	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C07:10	SWNETVELF	0.5775	0.9785	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C07:19	SWNETVELF	0.5492	0.873	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C07:80	SWNETVELF	0.5105	0.9763	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C07:67	SWNETVELF	0.5105	0.9763	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C07:46	SWNETVELF	0.4962	0.9492	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:10	SWNETVELF	0.2917	0.9513	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:07	SWNETVELF	0.281	0.9401	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:14	SWNETVELF	0.1636	0.9422	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:01	SWNETVEL	0.9943	0.9558	12	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C18:01	SWNETVEL	0.992	0.9551	12	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C14:03	SWNETVEL	0.9733	0.9752	12	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C14:02	SWNETVEL	0.9733	0.9752	12	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:04	SWNETVEL	0.9265	0.9675	12	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C15:02	KSWNETVEL	0.9997	0.9372	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C15:09	KSWNETVEL	0.9997	0.9621	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C15:05	KSWNETVEL	0.9996	0.9483	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C15:02	RSKSWNETV	0.9994	0.9184	9	18
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C15:05	RSKSWNETV	0.9992	0.9553	9	18
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:17	KSWNETVEL	0.9987	0.9902	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:05	KSWNETVEL	0.9981	0.9769	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A30:01	RSKSWNETV	0.9979	0.9432	9	18
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C16:02	KSWNETVEL	0.9975	0.9949	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:04	KSWNETVEL	0.9972	0.997	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:03	KSWNETVEL	0.9972	0.997	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B58:06	KSWNETVEL	0.9969	0.916	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B57:02	KSWNETVEL	0.9926	0.9397	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C03:06	KSWNETVEL	0.9923	0.9971	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C16:01	KSWNETVEL	0.9867	0.9866	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A32:01	KSWNETVEL	0.9841	0.966	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C08:01	KSWNETVEL	0.9135	0.9935	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A02:14	KSWNETVEL	0.9096	0.7624	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A02:06	KSWNETVEL	0.9053	0.8571	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B35:13	KSWNETVEL	0.8284	0.9577	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A25:01	DLLSRSKSW	0.8125	0.8741	5	14
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C17:01	KSWNETVEL	0.7117	0.9781	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B15:13	DLLSRSKSW	0.584	0.5778	5	14
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C07:17	SWNETVELF	0.5387	0.9754	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C07:02	SWNETVELF	0.5105	0.9763	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C14:03	SWNETVELF	0.2906	0.9707	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C14:02	SWNETVELF	0.2906	0.9707	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:01	SWNETVELF	0.281	0.9401	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C18:01	SWNETVELF	0.1846	0.9412	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B07:13	KSWNETVEL	0.18	0.8918	11	20
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C04:04	SWNETVELF	0.1196	0.9544	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-C06:06	SWNETVELF	0.0737	0.9921	12	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B57:10	KSWNETVELF	0.9999	0.9887	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B57:04	KSWNETVELF	0.9998	0.7536	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B58:06	KSWNETVELF	0.9996	0.9135	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-B57:02	KSWNETVELF	0.9987	0.9443	11	21
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	42	HLA-A32:01	KSWNETVELF	0.9962	0.9626	11	21

Top

Potential FusionNeoAntigen Information of PDE4D-DEPDC1B in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PDE4D-DEPDC1B

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5273	LLSRSKSWNETVEL	PDE4D	DEPDC1B	chr5	59481384	chr5	59983054	42

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PDE4D-DEPDC1B

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5273	LLSRSKSWNETVEL	-7.9962	-8.1096
HLA-B14:02	3BVN	5273	LLSRSKSWNETVEL	-5.70842	-6.74372
HLA-B52:01	3W39	5273	LLSRSKSWNETVEL	-6.83737	-6.95077
HLA-B52:01	3W39	5273	LLSRSKSWNETVEL	-4.4836	-5.5189
HLA-A11:01	4UQ2	5273	LLSRSKSWNETVEL	-10.0067	-10.1201
HLA-A11:01	4UQ2	5273	LLSRSKSWNETVEL	-9.03915	-10.0745
HLA-A24:02	5HGA	5273	LLSRSKSWNETVEL	-6.56204	-6.67544
HLA-A24:02	5HGA	5273	LLSRSKSWNETVEL	-5.42271	-6.45801
HLA-B44:05	3DX8	5273	LLSRSKSWNETVEL	-7.85648	-8.89178
HLA-B44:05	3DX8	5273	LLSRSKSWNETVEL	-5.3978	-5.5112
HLA-A02:01	6TDR	5273	LLSRSKSWNETVEL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of PDE4D-DEPDC1B

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	11	20	KSWNETVEL	AAAAGTTGGAATGAGACCGTGGAGCTT
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	11	21	KSWNETVELF	AAAAGTTGGAATGAGACCGTGGAGCTTTTT
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	12	20	SWNETVEL	AGTTGGAATGAGACCGTGGAGCTT
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	12	21	SWNETVELF	AGTTGGAATGAGACCGTGGAGCTTTTT
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	5	14	DLLSRSKSW	GATTTGCTTTCTCGGAGCAAAAGTTGG
PDE4D-DEPDC1B	chr5	59481384	chr5	59983054	9	18	RSKSWNETV	CGGAGCAAAAGTTGGAATGAGACCGTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PDE4D-DEPDC1B

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PRAD	PDE4D-DEPDC1B	chr5	59481384	ENST00000546160	chr5	59983054	ENST00000265036	TCGA-CH-5750

Top

Potential target of CAR-T therapy development for PDE4D-DEPDC1B

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PDE4D-DEPDC1B

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PDE4D-DEPDC1B

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)