Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ARID1A-RPS6KA1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ARID1A-RPS6KA1
	FusionPDB ID: 6390
	FusionGDB2.0 ID: 6390
		Hgene	Tgene
	Gene symbol	ARID1A	RPS6KA1
	Gene ID	8289	6195
	Gene name	AT-rich interaction domain 1A	ribosomal protein S6 kinase A1
	Synonyms	B120\|BAF250\|BAF250a\|BM029\|C1orf4\|CSS2\|ELD\|MRD14\|OSA1\|P270\|SMARCF1\|hELD\|hOSA1	HU-1\|MAPKAPK1\|MAPKAPK1A\|RSK\|RSK1\|p90Rsk
	Cytomap	1p36.11	1p36.11
	Type of gene	protein-coding	protein-coding
	Description	AT-rich interactive domain-containing protein 1AARID domain-containing protein 1AAT rich interactive domain 1A (SWI-like)BRG1-associated factor 250aOSA1 nuclear proteinSWI-like proteinSWI/SNF complex protein p270SWI/SNF-related, matrix-associated,	ribosomal protein S6 kinase alpha-190 kDa ribosomal protein S6 kinase 1MAP kinase-activated protein kinase 1aMAPK-activated protein kinase 1aMAPKAP kinase 1aMAPKAPK-1aRSK-1S6K-alpha 1dJ590P13.1 (ribosomal protein S6 kinase, 90kD, polypeptide 1)p9
	Modification date	20200329	20200327
	UniProtAcc	O14497 Main function of 5'-partner protein: FUNCTION: Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity). {ECO:0000250\|UniProtKB:A2BH40, ECO:0000303\|PubMed:12672490, ECO:0000303\|PubMed:22952240, ECO:0000303\|PubMed:26601204}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000324856, ENST00000374152, ENST00000457599, ENST00000540690,	ENST00000526792, ENST00000374162, ENST00000488985, ENST00000530003, ENST00000531382, ENST00000374166, ENST00000374168,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	29 X 19 X 15=8265	4 X 7 X 4=112
	# samples	45	7
	** MAII score	log2(45/8265*10)=-4.19901791296264 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/112*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ARID1A [Title/Abstract] AND RPS6KA1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ARID1A [Title/Abstract] AND RPS6KA1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ARID1A(27102198)-RPS6KA1(26897940), # samples:3
Anticipated loss of major functional domain due to fusion event.	ARID1A-RPS6KA1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ARID1A-RPS6KA1 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ARID1A	GO:0006337	nucleosome disassembly	8895581
Hgene	ARID1A	GO:0006338	chromatin remodeling	11726552
Hgene	ARID1A	GO:0030520	intracellular estrogen receptor signaling pathway	12200431
Hgene	ARID1A	GO:0030521	androgen receptor signaling pathway	12200431
Hgene	ARID1A	GO:0042921	glucocorticoid receptor signaling pathway	12200431
Hgene	ARID1A	GO:0045893	positive regulation of transcription, DNA-templated	12200431
Tgene	RPS6KA1	GO:0043154	negative regulation of cysteine-type endopeptidase activity involved in apoptotic process	18402937

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:27102198/chr1:26897940)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ARID1A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RPS6KA1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000374152	ARID1A	chr1	27105774	+	ENST00000374168	RPS6KA1	chr1	26873403	+	8609	5731	283	5730	1815
ENST00000374152	ARID1A	chr1	27105774	+	ENST00000374166	RPS6KA1	chr1	26873403	+	8565	5731	283	5730	1815
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000374168	RPS6KA1	chr1	26897940	+	6937	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000374166	RPS6KA1	chr1	26897940	+	6926	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000526792	RPS6KA1	chr1	26897940	+	6343	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000374162	RPS6KA1	chr1	26897940	+	6343	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000530003	RPS6KA1	chr1	26897940	+	6926	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000531382	RPS6KA1	chr1	26897940	+	6188	5495	371	6112	1913
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000374168	RPS6KA1	chr1	26897940	+	5915	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000374166	RPS6KA1	chr1	26897940	+	5904	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000526792	RPS6KA1	chr1	26897940	+	5321	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000374162	RPS6KA1	chr1	26897940	+	5321	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000530003	RPS6KA1	chr1	26897940	+	5904	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000531382	RPS6KA1	chr1	26897940	+	5166	4473	0	5090	1696
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000374168	RPS6KA1	chr1	26897940	+	5700	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000374166	RPS6KA1	chr1	26897940	+	5689	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000526792	RPS6KA1	chr1	26897940	+	5106	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000374162	RPS6KA1	chr1	26897940	+	5106	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000530003	RPS6KA1	chr1	26897940	+	5689	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000531382	RPS6KA1	chr1	26897940	+	4951	4258	283	4875	1530
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000374168	RPS6KA1	chr1	26897940	+	1983	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000374166	RPS6KA1	chr1	26897940	+	1972	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000526792	RPS6KA1	chr1	26897940	+	1389	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000374162	RPS6KA1	chr1	26897940	+	1389	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000530003	RPS6KA1	chr1	26897940	+	1972	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000531382	RPS6KA1	chr1	26897940	+	1234	541	433	1158	241
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000374168	RPS6KA1	chr1	26897939	+	6937	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000374166	RPS6KA1	chr1	26897939	+	6926	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000526792	RPS6KA1	chr1	26897939	+	6343	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000374162	RPS6KA1	chr1	26897939	+	6343	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000530003	RPS6KA1	chr1	26897939	+	6926	5495	371	6112	1913
ENST00000324856	ARID1A	chr1	27102198	+	ENST00000531382	RPS6KA1	chr1	26897939	+	6188	5495	371	6112	1913
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000374168	RPS6KA1	chr1	26897939	+	5915	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000374166	RPS6KA1	chr1	26897939	+	5904	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000526792	RPS6KA1	chr1	26897939	+	5321	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000374162	RPS6KA1	chr1	26897939	+	5321	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000530003	RPS6KA1	chr1	26897939	+	5904	4473	0	5090	1696
ENST00000457599	ARID1A	chr1	27102198	+	ENST00000531382	RPS6KA1	chr1	26897939	+	5166	4473	0	5090	1696
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000374168	RPS6KA1	chr1	26897939	+	5700	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000374166	RPS6KA1	chr1	26897939	+	5689	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000526792	RPS6KA1	chr1	26897939	+	5106	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000374162	RPS6KA1	chr1	26897939	+	5106	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000530003	RPS6KA1	chr1	26897939	+	5689	4258	283	4875	1530
ENST00000374152	ARID1A	chr1	27102198	+	ENST00000531382	RPS6KA1	chr1	26897939	+	4951	4258	283	4875	1530
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000374168	RPS6KA1	chr1	26897939	+	1983	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000374166	RPS6KA1	chr1	26897939	+	1972	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000526792	RPS6KA1	chr1	26897939	+	1389	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000374162	RPS6KA1	chr1	26897939	+	1389	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000530003	RPS6KA1	chr1	26897939	+	1972	541	433	1158	241
ENST00000540690	ARID1A	chr1	27102198	+	ENST00000531382	RPS6KA1	chr1	26897939	+	1234	541	433	1158	241

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000374152	ENST00000374168	ARID1A	chr1	27105774	+	RPS6KA1	chr1	26873403	+	0.006672164	0.99332786
ENST00000374152	ENST00000374166	ARID1A	chr1	27105774	+	RPS6KA1	chr1	26873403	+	0.006699403	0.99330056
ENST00000324856	ENST00000374168	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007896526	0.99210346
ENST00000324856	ENST00000374166	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007879256	0.99212074
ENST00000324856	ENST00000526792	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007839556	0.9921604
ENST00000324856	ENST00000374162	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007839556	0.9921604
ENST00000324856	ENST00000530003	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007879256	0.99212074
ENST00000324856	ENST00000531382	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007573821	0.99242616
ENST00000457599	ENST00000374168	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006967951	0.993032
ENST00000457599	ENST00000374166	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006926761	0.9930733
ENST00000457599	ENST00000526792	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007366736	0.9926333
ENST00000457599	ENST00000374162	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007366736	0.9926333
ENST00000457599	ENST00000530003	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006926761	0.9930733
ENST00000457599	ENST00000531382	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.007259963	0.9927401
ENST00000374152	ENST00000374168	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006980229	0.99301976
ENST00000374152	ENST00000374166	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006977384	0.9930226
ENST00000374152	ENST00000526792	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006950892	0.99304914
ENST00000374152	ENST00000374162	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006950892	0.99304914
ENST00000374152	ENST00000530003	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006977384	0.9930226
ENST00000374152	ENST00000531382	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.006750048	0.99325
ENST00000540690	ENST00000374168	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.012119216	0.9878807
ENST00000540690	ENST00000374166	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.012337024	0.987663
ENST00000540690	ENST00000526792	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.008140772	0.99185926
ENST00000540690	ENST00000374162	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.008140772	0.99185926
ENST00000540690	ENST00000530003	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.012337024	0.987663
ENST00000540690	ENST00000531382	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897940	+	0.005069501	0.99493045
ENST00000324856	ENST00000374168	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007896526	0.99210346
ENST00000324856	ENST00000374166	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007879256	0.99212074
ENST00000324856	ENST00000526792	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007839556	0.9921604
ENST00000324856	ENST00000374162	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007839556	0.9921604
ENST00000324856	ENST00000530003	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007879256	0.99212074
ENST00000324856	ENST00000531382	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007573821	0.99242616
ENST00000457599	ENST00000374168	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006967951	0.993032
ENST00000457599	ENST00000374166	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006926761	0.9930733
ENST00000457599	ENST00000526792	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007366736	0.9926333
ENST00000457599	ENST00000374162	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007366736	0.9926333
ENST00000457599	ENST00000530003	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006926761	0.9930733
ENST00000457599	ENST00000531382	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.007259963	0.9927401
ENST00000374152	ENST00000374168	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006980229	0.99301976
ENST00000374152	ENST00000374166	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006977384	0.9930226
ENST00000374152	ENST00000526792	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006950892	0.99304914
ENST00000374152	ENST00000374162	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006950892	0.99304914
ENST00000374152	ENST00000530003	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006977384	0.9930226
ENST00000374152	ENST00000531382	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.006750048	0.99325
ENST00000540690	ENST00000374168	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.012119216	0.9878807
ENST00000540690	ENST00000374166	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.012337024	0.987663
ENST00000540690	ENST00000526792	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.008140772	0.99185926
ENST00000540690	ENST00000374162	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.008140772	0.99185926
ENST00000540690	ENST00000530003	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.012337024	0.987663
ENST00000540690	ENST00000531382	ARID1A	chr1	27102198	+	RPS6KA1	chr1	26897939	+	0.005069501	0.99493045

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ARID1A-RPS6KA1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ARID1A	chr1	27102198	RPS6KA1	chr1	26897939	4258	1325	YDDNSIMTFNLSQVVHRDLKPSNILY
ARID1A	chr1	27102198	RPS6KA1	chr1	26897939	4473	1491	YDDNSIMTFNLSQVVHRDLKPSNILY
ARID1A	chr1	27102198	RPS6KA1	chr1	26897939	541	36	YDDNSIMTFNLSQVVHRDLKPSNILY
ARID1A	chr1	27102198	RPS6KA1	chr1	26897939	5495	1708	YDDNSIMTFNLSQVVHRDLKPSNILY
ARID1A	chr1	27102198	RPS6KA1	chr1	26897940	4258	1325	YDDNSIMTFNLSQVVHRDLKPSNILY
ARID1A	chr1	27102198	RPS6KA1	chr1	26897940	4473	1491	YDDNSIMTFNLSQVVHRDLKPSNILY
ARID1A	chr1	27102198	RPS6KA1	chr1	26897940	541	36	YDDNSIMTFNLSQVVHRDLKPSNILY
ARID1A	chr1	27102198	RPS6KA1	chr1	26897940	5495	1708	YDDNSIMTFNLSQVVHRDLKPSNILY

Top

Potential FusionNeoAntigen Information of ARID1A-RPS6KA1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ARID1A-RPS6KA1_27102198_26897939.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A02:13	IMTFNLSQV	0.9949	0.6146	5	14
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A02:27	IMTFNLSQV	0.994	0.5551	5	14
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A02:11	IMTFNLSQV	0.9908	0.5105	5	14
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A02:38	IMTFNLSQV	0.988	0.5837	5	14
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-B15:16	MTFNLSQVV	0.9308	0.8386	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-B13:02	MTFNLSQVV	0.8439	0.7144	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-B52:01	MTFNLSQVV	0.7346	0.9658	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A02:38	SIMTFNLSQV	0.9979	0.7172	4	14
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A31:02	TFNLSQVVHR	0.9539	0.5648	7	17
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A74:09	MTFNLSQVVHR	0.964	0.5872	6	17
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A74:11	MTFNLSQVVHR	0.964	0.5872	6	17
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A74:03	MTFNLSQVVHR	0.964	0.5872	6	17
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A31:02	MTFNLSQVVHR	0.9404	0.5726	6	17
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C15:06	MTFNLSQVV	0.999	0.7977	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C12:04	MTFNLSQVV	0.9887	0.9794	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C06:03	MTFNLSQVV	0.9879	0.9833	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C12:12	MTFNLSQVV	0.9792	0.8737	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C02:06	MTFNLSQVV	0.8982	0.9313	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-B51:07	MTFNLSQVV	0.7646	0.9641	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A31:01	TFNLSQVVHR	0.9456	0.5409	7	17
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A31:01	MTFNLSQVVHR	0.9732	0.5564	6	17
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C15:02	MTFNLSQVV	0.9993	0.7685	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C15:05	MTFNLSQVV	0.9991	0.8037	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A02:03	IMTFNLSQV	0.9981	0.6378	5	14
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A68:02	MTFNLSQVV	0.9977	0.5932	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A69:01	MTFNLSQVV	0.9953	0.5832	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C16:04	MTFNLSQVV	0.993	0.9517	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-C12:03	MTFNLSQVV	0.9752	0.9488	6	15
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	HLA-A74:01	MTFNLSQVVHR	0.964	0.5872	6	17

Top

Potential FusionNeoAntigen Information of ARID1A-RPS6KA1 in HLA II

ARID1A-RPS6KA1_27102198_26897939.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB3-0201	NSIMTFNLSQVVHRD	3	18
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB3-0209	NSIMTFNLSQVVHRD	3	18
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB3-0211	NSIMTFNLSQVVHRD	3	18
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB3-0216	NSIMTFNLSQVVHRD	3	18
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB3-0221	NSIMTFNLSQVVHRD	3	18
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB3-0224	NSIMTFNLSQVVHRD	3	18
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB3-0301	NSIMTFNLSQVVHRD	3	18
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB3-0303	NSIMTFNLSQVVHRD	3	18
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5495	DRB5-0112	IMTFNLSQVVHRDLK	5	20

Top

Fusion breakpoint peptide structures of ARID1A-RPS6KA1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6030	MTFNLSQVVHRDLK	ARID1A	RPS6KA1	chr1	27102198	chr1	26897939	5495

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ARID1A-RPS6KA1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6030	MTFNLSQVVHRDLK	-7.64441	-7.75781
HLA-B14:02	3BVN	6030	MTFNLSQVVHRDLK	-5.94416	-6.97946
HLA-B52:01	3W39	6030	MTFNLSQVVHRDLK	-6.36431	-6.47771
HLA-B52:01	3W39	6030	MTFNLSQVVHRDLK	-5.79427	-6.82957
HLA-A24:02	5HGA	6030	MTFNLSQVVHRDLK	-7.67647	-8.71177
HLA-A24:02	5HGA	6030	MTFNLSQVVHRDLK	-6.37962	-6.49302
HLA-B44:05	3DX8	6030	MTFNLSQVVHRDLK	-7.31799	-7.43139
HLA-B44:05	3DX8	6030	MTFNLSQVVHRDLK	-5.80727	-6.84257

Top

Vaccine Design for the FusionNeoAntigens of ARID1A-RPS6KA1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	4	14	SIMTFNLSQV	AGCATCATGACCTTCAACCTCAGTCAGGTT
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5	14	IMTFNLSQV	ATCATGACCTTCAACCTCAGTCAGGTT
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	6	15	MTFNLSQVV	ATGACCTTCAACCTCAGTCAGGTTGTG
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	6	17	MTFNLSQVVHR	ATGACCTTCAACCTCAGTCAGGTTGTGCACAGG
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	7	17	TFNLSQVVHR	ACCTTCAACCTCAGTCAGGTTGTGCACAGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	3	18	NSIMTFNLSQVVHRD	AACAGCATCATGACCTTCAACCTCAGTCAGGTTGTGCACAGGGAC
ARID1A-RPS6KA1	chr1	27102198	chr1	26897939	5	20	IMTFNLSQVVHRDLK	ATCATGACCTTCAACCTCAGTCAGGTTGTGCACAGGGACCTGAAG

Top

Information of the samples that have these potential fusion neoantigens of ARID1A-RPS6KA1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ARID1A-RPS6KA1	chr1	27102198	ENST00000324856	chr1	26897939	ENST00000374162	TCGA-HU-A4GH

Top

Potential target of CAR-T therapy development for ARID1A-RPS6KA1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ARID1A-RPS6KA1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ARID1A-RPS6KA1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	ARID1A	C0024623	Malignant neoplasm of stomach	3	CTD_human
Hgene	ARID1A	C0038356	Stomach Neoplasms	3	CTD_human
Hgene	ARID1A	C1708349	Hereditary Diffuse Gastric Cancer	3	CTD_human
Hgene	ARID1A	C2239176	Liver carcinoma	3	CTD_human
Hgene	ARID1A	C0033578	Prostatic Neoplasms	2	CTD_human
Hgene	ARID1A	C0376358	Malignant neoplasm of prostate	2	CTD_human
Hgene	ARID1A	C0001418	Adenocarcinoma	1	CTD_human
Hgene	ARID1A	C0005684	Malignant neoplasm of urinary bladder	1	CTD_human
Hgene	ARID1A	C0005695	Bladder Neoplasm	1	CTD_human
Hgene	ARID1A	C0006413	Burkitt Lymphoma	1	CTD_human
Hgene	ARID1A	C0007138	Carcinoma, Transitional Cell	1	CTD_human
Hgene	ARID1A	C0009402	Colorectal Carcinoma	1	CTD_human
Hgene	ARID1A	C0009404	Colorectal Neoplasms	1	CTD_human
Hgene	ARID1A	C0010606	Adenoid Cystic Carcinoma	1	CTD_human
Hgene	ARID1A	C0014170	Endometrial Neoplasms	1	CTD_human
Hgene	ARID1A	C0027708	Nephroblastoma	1	CTD_human
Hgene	ARID1A	C0027819	Neuroblastoma	1	CTD_human
Hgene	ARID1A	C0036920	Sezary Syndrome	1	CTD_human
Hgene	ARID1A	C0079772	T-Cell Lymphoma	1	CTD_human
Hgene	ARID1A	C0079773	Lymphoma, T-Cell, Cutaneous	1	CTD_human
Hgene	ARID1A	C0205641	Adenocarcinoma, Basal Cell	1	CTD_human
Hgene	ARID1A	C0205642	Adenocarcinoma, Oxyphilic	1	CTD_human
Hgene	ARID1A	C0205643	Carcinoma, Cribriform	1	CTD_human
Hgene	ARID1A	C0205644	Carcinoma, Granular Cell	1	CTD_human
Hgene	ARID1A	C0205645	Adenocarcinoma, Tubular	1	CTD_human
Hgene	ARID1A	C0206656	Embryonal Rhabdomyosarcoma	1	CTD_human
Hgene	ARID1A	C0206698	Cholangiocarcinoma	1	CTD_human
Hgene	ARID1A	C0265338	Coffin-Siris syndrome	1	CTD_human;GENOMICS_ENGLAND
Hgene	ARID1A	C0279628	Adenocarcinoma Of Esophagus	1	CTD_human
Hgene	ARID1A	C0343640	African Burkitt's lymphoma	1	CTD_human
Hgene	ARID1A	C0345905	Intrahepatic Cholangiocarcinoma	1	CTD_human
Hgene	ARID1A	C0376407	Granulomatous Slack Skin	1	CTD_human
Hgene	ARID1A	C0476089	Endometrial Carcinoma	1	CTD_human
Hgene	ARID1A	C0920269	Microsatellite Instability	1	CTD_human
Hgene	ARID1A	C1721098	Replication Error Phenotype	1	CTD_human
Hgene	ARID1A	C2930471	Bilateral Wilms Tumor	1	CTD_human
Hgene	ARID1A	C2931822	Nasopharyngeal carcinoma	1	CTD_human
Hgene	ARID1A	C3805278	Extrahepatic Cholangiocarcinoma	1	CTD_human
Hgene	ARID1A	C4721444	Burkitt Leukemia	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)