Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PHF21A-NUTF2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PHF21A-NUTF2
	FusionPDB ID: 64851
	FusionGDB2.0 ID: 64851
		Hgene	Tgene
	Gene symbol	PHF21A	NUTF2
	Gene ID	51317	10204
	Gene name	PHD finger protein 21A	nuclear transport factor 2
	Synonyms	BHC80\|BM-006\|IDDBCS\|NEDMS	NTF-2\|NTF2\|PP15
	Cytomap	11p11.2	16q22.1
	Type of gene	protein-coding	protein-coding
	Description	PHD finger protein 21ABHC80aBRAF35-HDAC complex protein BHC80BRAF35/HDAC2 complex (80 kDa)	nuclear transport factor 2placental protein 15
	Modification date	20200327	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000257821, ENST00000323180, ENST00000418153, ENST00000527753,	ENST00000219169, ENST00000568396, ENST00000569436,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	19 X 13 X 12=2964	12 X 9 X 6=648
	# samples	22	15
	** MAII score	log2(22/2964*10)=-3.75197001878117 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/648*10)=-2.11103131238874 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PHF21A [Title/Abstract] AND NUTF2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PHF21A [Title/Abstract] AND NUTF2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PHF21A(46098305)-NUTF2(67902243), # samples:3
Anticipated loss of major functional domain due to fusion event.	PHF21A-NUTF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PHF21A-NUTF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	NUTF2	GO:0006606	protein import into nucleus	7744965\|10679025
Tgene	NUTF2	GO:0006611	protein export from nucleus	16449645

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:46098305/chr16:67902243)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PHF21A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NUTF2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000257821	PHF21A	chr11	46098305	-	ENST00000219169	NUTF2	chr16	67902243	+	2716	777	1668	2117	149
ENST00000257821	PHF21A	chr11	46098305	-	ENST00000569436	NUTF2	chr16	67902243	+	1472	777	624	1061	145
ENST00000257821	PHF21A	chr11	46098305	-	ENST00000568396	NUTF2	chr16	67902243	+	1472	777	624	1061	145
ENST00000323180	PHF21A	chr11	46098305	-	ENST00000219169	NUTF2	chr16	67902243	+	2460	521	1412	1861	149
ENST00000323180	PHF21A	chr11	46098305	-	ENST00000569436	NUTF2	chr16	67902243	+	1216	521	368	805	145
ENST00000323180	PHF21A	chr11	46098305	-	ENST00000568396	NUTF2	chr16	67902243	+	1216	521	368	805	145
ENST00000418153	PHF21A	chr11	46098305	-	ENST00000219169	NUTF2	chr16	67902243	+	2292	353	1244	1693	149
ENST00000418153	PHF21A	chr11	46098305	-	ENST00000569436	NUTF2	chr16	67902243	+	1048	353	200	637	145
ENST00000418153	PHF21A	chr11	46098305	-	ENST00000568396	NUTF2	chr16	67902243	+	1048	353	200	637	145

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000257821	ENST00000219169	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.010537723	0.9894623
ENST00000257821	ENST00000569436	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.006796772	0.99320316
ENST00000257821	ENST00000568396	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.006796772	0.99320316
ENST00000323180	ENST00000219169	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.006899397	0.99310064
ENST00000323180	ENST00000569436	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.004278186	0.9957218
ENST00000323180	ENST00000568396	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.004278186	0.9957218
ENST00000418153	ENST00000219169	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.008984393	0.9910156
ENST00000418153	ENST00000569436	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.004124834	0.9958752
ENST00000418153	ENST00000568396	PHF21A	chr11	46098305	-	NUTF2	chr16	67902243	+	0.004124834	0.9958752

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PHF21A-NUTF2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PHF21A	chr11	46098305	NUTF2	chr16	67902243	353	50	HELQAKITALSEKQIDASCLTWEGQQ
PHF21A	chr11	46098305	NUTF2	chr16	67902243	521	50	HELQAKITALSEKQIDASCLTWEGQQ
PHF21A	chr11	46098305	NUTF2	chr16	67902243	777	50	HELQAKITALSEKQIDASCLTWEGQQ

Top

Potential FusionNeoAntigen Information of PHF21A-NUTF2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PHF21A-NUTF2_46098305_67902243.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B48:01	KQIDASCL	0.9978	0.7086	12	20
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B39:13	KQIDASCL	0.9298	0.9491	12	20
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B45:01	SEKQIDASC	0.9801	0.7964	10	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-A02:13	ALSEKQIDA	0.9697	0.5152	8	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B50:02	SEKQIDASC	0.9604	0.5197	10	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B41:01	SEKQIDASC	0.3916	0.8085	10	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B50:01	SEKQIDASC	0.127	0.6463	10	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B57:01	KQIDASCLTW	0.999	0.9956	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-A31:08	KQIDASCLTW	0.9955	0.9529	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B58:02	KQIDASCLTW	0.9948	0.9869	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B58:01	KQIDASCLTW	0.9933	0.994	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B57:03	KQIDASCLTW	0.9898	0.9986	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B47:01	KQIDASCLTW	0.9707	0.8102	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-A32:13	KQIDASCLTW	0.9649	0.9901	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B13:01	KQIDASCLTW	0.8362	0.998	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-A24:14	KQIDASCLTW	0.7685	0.8031	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B40:06	SEKQIDASC	0.9863	0.6412	10	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B44:08	KQIDASCLTW	0.9646	0.9515	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:05	KQIDASCLTW	0.9319	0.9341	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B48:05	KQIDASCL	0.6356	0.6199	12	20
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B50:05	SEKQIDASC	0.127	0.6463	10	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B50:04	SEKQIDASC	0.127	0.6463	10	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:24	KQIDASCLTW	0.9998	0.994	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:53	KQIDASCLTW	0.9994	0.9733	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:135	KQIDASCLTW	0.9992	0.9745	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B57:10	KQIDASCLTW	0.999	0.9956	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B57:04	KQIDASCLTW	0.9962	0.9331	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-A32:01	KQIDASCLTW	0.9933	0.9959	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B40:04	SEKQIDASCL	0.9882	0.6833	10	20
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:54	KQIDASCLTW	0.987	0.9702	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B58:06	KQIDASCLTW	0.9858	0.9875	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B57:02	KQIDASCLTW	0.985	0.996	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:13	KQIDASCLTW	0.9556	0.985	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:68	KQIDASCLTW	0.9498	0.9435	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B48:02	KQIDASCLTW	0.9335	0.9381	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:20	KQIDASCLTW	0.927	0.94	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B35:28	KQIDASCLTW	0.9082	0.94	12	22
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	HLA-B15:24	EKQIDASCLTW	0.9926	0.9785	11	22

Top

Potential FusionNeoAntigen Information of PHF21A-NUTF2 in HLA II

PHF21A-NUTF2_46098305_67902243.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-0123	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-0437	HELQAKITALSEKQI	0	15
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-0804	HELQAKITALSEKQI	0	15
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1201	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1201	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1201	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1201	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1203	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1203	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1203	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1203	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1204	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1204	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1205	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1205	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1205	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1205	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1206	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1206	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1206	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1206	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1207	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1207	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1207	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1207	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1208	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1208	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1208	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1208	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1209	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1209	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1210	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1210	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1210	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1210	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1211	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1211	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1211	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1211	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1212	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1212	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1212	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1212	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1213	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1213	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1213	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1213	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1214	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1214	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1214	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1214	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1215	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1215	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1215	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1215	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1216	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1216	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1216	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1216	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1217	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1217	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1217	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1217	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1218	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1218	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1218	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1218	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1219	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1219	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1219	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1219	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1220	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1220	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1220	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1220	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1221	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1221	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1221	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1221	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1222	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1222	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1223	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1223	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1223	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1223	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1354	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1377	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1377	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1415	HELQAKITALSEKQI	0	15
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1431	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1503	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1503	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1503	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1503	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1504	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1510	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1521	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1521	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1523	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1523	LQAKITALSEKQIDA	2	17
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1523	ELQAKITALSEKQID	1	16
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1523	AKITALSEKQIDASC	4	19
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1615	QAKITALSEKQIDAS	3	18
PHF21A-NUTF2	chr11	46098305	chr16	67902243	777	DRB1-1615	LQAKITALSEKQIDA	2	17

Top

Fusion breakpoint peptide structures of PHF21A-NUTF2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4010	ITALSEKQIDASCL	PHF21A	NUTF2	chr11	46098305	chr16	67902243	777

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PHF21A-NUTF2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4010	ITALSEKQIDASCL	-7.15543	-7.26883
HLA-B14:02	3BVN	4010	ITALSEKQIDASCL	-4.77435	-5.80965
HLA-B52:01	3W39	4010	ITALSEKQIDASCL	-6.80875	-6.92215
HLA-B52:01	3W39	4010	ITALSEKQIDASCL	-4.20386	-5.23916
HLA-A11:01	4UQ2	4010	ITALSEKQIDASCL	-7.5194	-8.5547
HLA-A11:01	4UQ2	4010	ITALSEKQIDASCL	-6.9601	-7.0735
HLA-A24:02	5HGA	4010	ITALSEKQIDASCL	-7.52403	-7.63743
HLA-A24:02	5HGA	4010	ITALSEKQIDASCL	-5.82433	-6.85963
HLA-B27:05	6PYJ	4010	ITALSEKQIDASCL	-3.28285	-4.31815
HLA-B44:05	3DX8	4010	ITALSEKQIDASCL	-5.91172	-6.94702
HLA-B44:05	3DX8	4010	ITALSEKQIDASCL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of PHF21A-NUTF2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PHF21A-NUTF2	chr11	46098305	chr16	67902243	10	19	SEKQIDASC	GAGAAACAGATTGACGCGTCATGCCTT
PHF21A-NUTF2	chr11	46098305	chr16	67902243	10	20	SEKQIDASCL	GAGAAACAGATTGACGCGTCATGCCTTACG
PHF21A-NUTF2	chr11	46098305	chr16	67902243	11	22	EKQIDASCLTW	AAACAGATTGACGCGTCATGCCTTACGTGGGAA
PHF21A-NUTF2	chr11	46098305	chr16	67902243	12	20	KQIDASCL	CAGATTGACGCGTCATGCCTTACG
PHF21A-NUTF2	chr11	46098305	chr16	67902243	12	22	KQIDASCLTW	CAGATTGACGCGTCATGCCTTACGTGGGAA
PHF21A-NUTF2	chr11	46098305	chr16	67902243	8	17	ALSEKQIDA	TTGAGTGAGAAACAGATTGACGCGTCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PHF21A-NUTF2	chr11	46098305	chr16	67902243	0	15	HELQAKITALSEKQI	GAACTCCAAGCCAAAATCACAGCTTTGAGTGAGAAACAGATTGAC
PHF21A-NUTF2	chr11	46098305	chr16	67902243	1	16	ELQAKITALSEKQID	CTCCAAGCCAAAATCACAGCTTTGAGTGAGAAACAGATTGACGCG
PHF21A-NUTF2	chr11	46098305	chr16	67902243	2	17	LQAKITALSEKQIDA	CAAGCCAAAATCACAGCTTTGAGTGAGAAACAGATTGACGCGTCA
PHF21A-NUTF2	chr11	46098305	chr16	67902243	3	18	QAKITALSEKQIDAS	GCCAAAATCACAGCTTTGAGTGAGAAACAGATTGACGCGTCATGC
PHF21A-NUTF2	chr11	46098305	chr16	67902243	4	19	AKITALSEKQIDASC	AAAATCACAGCTTTGAGTGAGAAACAGATTGACGCGTCATGCCTT

Top

Information of the samples that have these potential fusion neoantigens of PHF21A-NUTF2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	PHF21A-NUTF2	chr11	46098305	ENST00000257821	chr16	67902243	ENST00000568396	TCGA-2F-A9KP-01A

Top

Potential target of CAR-T therapy development for PHF21A-NUTF2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PHF21A-NUTF2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PHF21A-NUTF2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)