Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PITRM1-MAP3K7

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PITRM1-MAP3K7
	FusionPDB ID: 65625
	FusionGDB2.0 ID: 65625
		Hgene	Tgene
	Gene symbol	PITRM1	MAP3K7
	Gene ID	10531	6885
	Gene name	pitrilysin metallopeptidase 1	mitogen-activated protein kinase kinase kinase 7
	Synonyms	MP1\|PreP	CSCF\|FMD2\|MEKK7\|TAK1\|TGF1a
	Cytomap	10p15.2	6q15
	Type of gene	protein-coding	protein-coding
	Description	presequence protease, mitochondrialPreP peptidasomemetalloprotease 1 (pitrilysin family)pitrilysin metalloproteinase 1	mitogen-activated protein kinase kinase kinase 7TGF-beta activated kinase 1transforming growth factor-beta-activated kinase 1
	Modification date	20200313	20200313
	UniProtAcc	.	P57077 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000224949, ENST00000380989, ENST00000380994, ENST00000451104, ENST00000464395,	ENST00000369320, ENST00000479630, ENST00000369325, ENST00000369327, ENST00000369329, ENST00000369332,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 4 X 4=80	6 X 7 X 4=168
	# samples	5	7
	** MAII score	log2(5/80*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PITRM1 [Title/Abstract] AND MAP3K7 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PITRM1 [Title/Abstract] AND MAP3K7 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PITRM1(3187788)-MAP3K7(91260268), # samples:1
Anticipated loss of major functional domain due to fusion event.	PITRM1-MAP3K7 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PITRM1-MAP3K7 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PITRM1-MAP3K7 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. PITRM1-MAP3K7 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. PITRM1-MAP3K7 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. PITRM1-MAP3K7 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PITRM1	GO:0006508	proteolysis	10360838\|19196155
Tgene	MAP3K7	GO:0000186	activation of MAPKK activity	8663074\|9079627
Tgene	MAP3K7	GO:0000187	activation of MAPK activity	9079627
Tgene	MAP3K7	GO:0007252	I-kappaB phosphorylation	11460167
Tgene	MAP3K7	GO:0007254	JNK cascade	9079627
Tgene	MAP3K7	GO:0043507	positive regulation of JUN kinase activity	11460167
Tgene	MAP3K7	GO:0043966	histone H3 acetylation	18838386
Tgene	MAP3K7	GO:0051403	stress-activated MAPK cascade	9079627

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:3187788/chr6:91260268)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PITRM1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MAP3K7 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000224949	PITRM1	chr10	3187788	-	ENST00000369325	MAP3K7	chr6	91260268	-	6258	2492	35	3181	1048
ENST00000224949	PITRM1	chr10	3187788	-	ENST00000369327	MAP3K7	chr6	91260268	-	6177	2492	35	3100	1021
ENST00000224949	PITRM1	chr10	3187788	-	ENST00000369332	MAP3K7	chr6	91260268	-	6293	2492	35	3364	1109
ENST00000224949	PITRM1	chr10	3187788	-	ENST00000369329	MAP3K7	chr6	91260268	-	6374	2492	35	3445	1136
ENST00000380989	PITRM1	chr10	3187788	-	ENST00000369325	MAP3K7	chr6	91260268	-	6265	2499	39	3188	1049
ENST00000380989	PITRM1	chr10	3187788	-	ENST00000369327	MAP3K7	chr6	91260268	-	6184	2499	39	3107	1022
ENST00000380989	PITRM1	chr10	3187788	-	ENST00000369332	MAP3K7	chr6	91260268	-	6300	2499	39	3371	1110
ENST00000380989	PITRM1	chr10	3187788	-	ENST00000369329	MAP3K7	chr6	91260268	-	6381	2499	39	3452	1137
ENST00000451104	PITRM1	chr10	3187788	-	ENST00000369325	MAP3K7	chr6	91260268	-	5932	2166	3	2855	950
ENST00000451104	PITRM1	chr10	3187788	-	ENST00000369327	MAP3K7	chr6	91260268	-	5851	2166	3	2774	923
ENST00000451104	PITRM1	chr10	3187788	-	ENST00000369332	MAP3K7	chr6	91260268	-	5967	2166	3	3038	1011
ENST00000451104	PITRM1	chr10	3187788	-	ENST00000369329	MAP3K7	chr6	91260268	-	6048	2166	3	3119	1038

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000224949	ENST00000369325	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000182959	0.9998171
ENST00000224949	ENST00000369327	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000207693	0.9997923
ENST00000224949	ENST00000369332	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000226923	0.9997731
ENST00000224949	ENST00000369329	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000276405	0.9997236
ENST00000380989	ENST00000369325	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000134791	0.9998652
ENST00000380989	ENST00000369327	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000135467	0.99986446
ENST00000380989	ENST00000369332	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000295436	0.99970454
ENST00000380989	ENST00000369329	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000323956	0.9996761
ENST00000451104	ENST00000369325	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000271462	0.9997285
ENST00000451104	ENST00000369327	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000348931	0.9996511
ENST00000451104	ENST00000369332	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000192169	0.9998079
ENST00000451104	ENST00000369329	PITRM1	chr10	3187788	-	MAP3K7	chr6	91260268	-	0.000173446	0.9998266

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PITRM1-MAP3K7

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PITRM1	chr10	3187788	MAP3K7	chr6	91260268	2166	721	KKERRPVRPHTVEYFPGADEPLQYPC
PITRM1	chr10	3187788	MAP3K7	chr6	91260268	2492	819	KKERRPVRPHTVEYFPGADEPLQYPC
PITRM1	chr10	3187788	MAP3K7	chr6	91260268	2499	820	KKERRPVRPHTVEYFPGADEPLQYPC

Top

Potential FusionNeoAntigen Information of PITRM1-MAP3K7 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PITRM1-MAP3K7_3187788_91260268.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:18	VRPHTVEY	0.9802	0.7217	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:01	PVRPHTVEY	0.9959	0.8505	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:25	PVRPHTVEY	0.9629	0.8868	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:02	PVRPHTVEY	0.9456	0.9038	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A02:21	HTVEYFPGA	0.8516	0.8014	9	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:01	RPVRPHTVEY	0.9836	0.8724	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:25	RPVRPHTVEY	0.9736	0.9126	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:01	RPVRPHTVEY	0.9725	0.8851	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:08	RPVRPHTVEY	0.9689	0.795	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:02	RPVRPHTVEY	0.9676	0.9255	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B45:01	VEYFPGADEP	0.912	0.8828	11	21
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:05	RPVRPHTVEY	0.9065	0.6704	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B50:02	VEYFPGADEP	0.8497	0.5796	11	21
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B41:01	VEYFPGADEP	0.8361	0.9509	11	21
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B50:01	VEYFPGADEP	0.8232	0.7695	11	21
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:17	RPVRPHTVEY	0.7998	0.876	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A30:08	RPVRPHTVEY	0.5739	0.6309	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A32:13	RPVRPHTVEY	0.1358	0.876	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B27:05	RRPVRPHTVEY	0.9999	0.6967	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B27:04	RRPVRPHTVEY	0.9998	0.6556	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B07:02	RPVRPHTVEYF	0.9995	0.5053	4	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:01	RRPVRPHTVEY	0.9909	0.8719	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:25	RRPVRPHTVEY	0.983	0.8971	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A30:08	RRPVRPHTVEY	0.9322	0.6507	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:95	VRPHTVEY	0.9974	0.6729	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:19	VRPHTVEY	0.9967	0.7094	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:27	VRPHTVEY	0.9966	0.9527	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:67	VRPHTVEY	0.9949	0.9455	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:80	VRPHTVEY	0.9949	0.9455	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:46	VRPHTVEY	0.9938	0.8848	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:10	VRPHTVEY	0.9935	0.9485	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:05	VRPHTVEY	0.9671	0.9536	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C12:16	VRPHTVEY	0.945	0.944	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:95	VRPHTVEYF	0.9876	0.7233	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:05	VRPHTVEYF	0.9858	0.9638	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:27	VRPHTVEYF	0.9531	0.9612	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:21	PVRPHTVEY	0.9494	0.8761	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:29	VRPHTVEYF	0.9008	0.9458	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:31	PVRPHTVEY	0.8757	0.8503	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:07	PVRPHTVEY	0.8637	0.6213	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:13	VRPHTVEYF	0.8486	0.9489	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:19	VRPHTVEYF	0.8268	0.7518	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:67	VRPHTVEYF	0.8177	0.9611	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:80	VRPHTVEYF	0.8177	0.9611	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:46	VRPHTVEYF	0.8025	0.9137	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:10	VRPHTVEYF	0.7992	0.9639	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:04	PVRPHTVEY	0.6856	0.8541	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C15:04	PVRPHTVEY	0.0658	0.9209	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C12:16	VRPHTVEYF	0.0456	0.9537	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:31	RPVRPHTVEY	0.984	0.8727	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:05	RPVRPHTVEY	0.9718	0.8576	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:21	RPVRPHTVEY	0.9573	0.8989	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:07	RPVRPHTVEY	0.9526	0.7197	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B07:12	RPVRPHTVEY	0.9232	0.6379	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:04	RPVRPHTVEY	0.8942	0.913	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C15:04	RPVRPHTVEY	0.6407	0.9158	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B07:12	RPVRPHTVEYF	0.999	0.7264	4	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B27:03	RRPVRPHTVEY	0.9988	0.7199	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:95	RRPVRPHTVEY	0.9974	0.5384	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:27	RRPVRPHTVEY	0.997	0.934	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:19	RRPVRPHTVEY	0.9962	0.6151	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:05	RRPVRPHTVEY	0.9959	0.902	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:80	RRPVRPHTVEY	0.9953	0.9501	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:67	RRPVRPHTVEY	0.9953	0.9501	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:10	RRPVRPHTVEY	0.9937	0.9649	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:46	RRPVRPHTVEY	0.9912	0.8688	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:07	RRPVRPHTVEY	0.9822	0.6965	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:04	RRPVRPHTVEY	0.9786	0.9146	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C15:04	RRPVRPHTVEY	0.9577	0.9133	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C12:16	RRPVRPHTVEY	0.9533	0.9606	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:22	VRPHTVEY	0.998	0.6536	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:01	VRPHTVEY	0.9978	0.6234	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:02	VRPHTVEY	0.9949	0.9455	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:17	VRPHTVEY	0.9938	0.9569	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:08	VRPHTVEY	0.9877	0.989	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:06	VRPHTVEY	0.9597	0.9897	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:02	VRPHTVEY	0.8523	0.9891	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:17	VRPHTVEY	0.8523	0.9891	6	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:27	PVRPHTVEY	0.996	0.851	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:34	PVRPHTVEY	0.9959	0.8505	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:33	PVRPHTVEY	0.9959	0.8505	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:125	PVRPHTVEY	0.9959	0.8505	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:135	PVRPHTVEY	0.9953	0.855	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:11	PVRPHTVEY	0.9932	0.8116	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:08	PVRPHTVEY	0.9931	0.811	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A68:02	HTVEYFPGA	0.9918	0.7349	9	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:43	PVRPHTVEY	0.9905	0.8129	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:01	VRPHTVEYF	0.9902	0.687	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:50	PVRPHTVEY	0.9857	0.872	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A69:01	HTVEYFPGA	0.9814	0.8297	9	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:39	PVRPHTVEY	0.9586	0.7572	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:24	PVRPHTVEY	0.9424	0.7951	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:11	PVRPHTVEY	0.9356	0.8559	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:17	VRPHTVEYF	0.9297	0.9685	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:12	PVRPHTVEY	0.9278	0.8314	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:22	VRPHTVEYF	0.8868	0.7214	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:35	PVRPHTVEY	0.8844	0.8271	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A02:06	HTVEYFPGA	0.8516	0.8014	9	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:08	VRPHTVEYF	0.8464	0.9802	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:02	VRPHTVEYF	0.8177	0.9611	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:13	PVRPHTVEY	0.6408	0.6151	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:04	VRPHTVEYF	0.5328	0.9471	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A25:01	PVRPHTVEY	0.4695	0.7841	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C12:02	PVRPHTVEY	0.4094	0.9648	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C03:67	VRPHTVEYF	0.3443	0.9577	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C03:02	PVRPHTVEY	0.259	0.9706	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:06	VRPHTVEYF	0.1597	0.9923	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C15:09	PVRPHTVEY	0.0658	0.9209	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:17	VRPHTVEYF	0.0184	0.9918	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:02	VRPHTVEYF	0.0184	0.9918	6	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C02:10	PVRPHTVEY	0.0163	0.9717	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C02:02	PVRPHTVEY	0.0163	0.9717	5	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:77	RPVRPHTVEY	0.9836	0.8724	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:23	RPVRPHTVEY	0.9817	0.8417	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:20	RPVRPHTVEY	0.9816	0.9127	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:20	RPVRPHTVEY	0.9756	0.9051	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:39	RPVRPHTVEY	0.9744	0.7915	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:34	RPVRPHTVEY	0.9725	0.8851	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:125	RPVRPHTVEY	0.9725	0.8851	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:33	RPVRPHTVEY	0.9725	0.8851	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:27	RPVRPHTVEY	0.9719	0.8941	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:11	RPVRPHTVEY	0.9702	0.8523	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:08	RPVRPHTVEY	0.9693	0.8467	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:135	RPVRPHTVEY	0.9681	0.8933	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:11	RPVRPHTVEY	0.966	0.8837	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:43	RPVRPHTVEY	0.9621	0.8507	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:12	RPVRPHTVEY	0.9541	0.8766	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:53	RPVRPHTVEY	0.9488	0.8666	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:50	RPVRPHTVEY	0.9474	0.8611	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:17	RPVRPHTVEY	0.946	0.7888	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:30	RPVRPHTVEY	0.946	0.7888	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:35	RPVRPHTVEY	0.9449	0.8934	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:24	RPVRPHTVEY	0.928	0.76	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C02:10	RPVRPHTVEY	0.8863	0.9734	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C02:02	RPVRPHTVEY	0.8863	0.9734	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B35:24	RPVRPHTVEY	0.8626	0.8509	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B50:05	VEYFPGADEP	0.8232	0.7695	11	21
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B50:04	VEYFPGADEP	0.8232	0.7695	11	21
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:13	RPVRPHTVEY	0.8148	0.627	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:68	RPVRPHTVEY	0.7895	0.6412	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B58:06	RPVRPHTVEY	0.7626	0.7303	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C12:02	RPVRPHTVEY	0.7317	0.9685	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C15:09	RPVRPHTVEY	0.6407	0.9158	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A30:01	RPVRPHTVEY	0.5994	0.827	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A32:01	RPVRPHTVEY	0.3361	0.8947	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B18:07	RPVRPHTVEY	0.2821	0.7362	4	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B27:08	RRPVRPHTVEY	0.9999	0.5827	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B27:10	RRPVRPHTVEY	0.9998	0.7807	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B07:22	RPVRPHTVEYF	0.9995	0.5053	4	15
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:22	RRPVRPHTVEY	0.9964	0.618	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:02	RRPVRPHTVEY	0.9953	0.9501	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C07:17	RRPVRPHTVEY	0.9939	0.9634	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:08	RRPVRPHTVEY	0.9936	0.9888	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:135	RRPVRPHTVEY	0.9925	0.8911	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:12	RRPVRPHTVEY	0.9917	0.8593	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:27	RRPVRPHTVEY	0.9915	0.8946	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:33	RRPVRPHTVEY	0.9909	0.8719	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:34	RRPVRPHTVEY	0.9909	0.8719	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:125	RRPVRPHTVEY	0.9909	0.8719	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:50	RRPVRPHTVEY	0.9863	0.8443	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:39	RRPVRPHTVEY	0.9857	0.7781	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:35	RRPVRPHTVEY	0.9823	0.8948	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:68	RRPVRPHTVEY	0.9751	0.605	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C15:09	RRPVRPHTVEY	0.9577	0.9133	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-B15:54	RRPVRPHTVEY	0.9472	0.8287	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A30:01	RRPVRPHTVEY	0.9446	0.8473	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:02	RRPVRPHTVEY	0.8998	0.9921	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-C06:17	RRPVRPHTVEY	0.8998	0.9921	3	14
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	HLA-A32:01	RRPVRPHTVEY	0.737	0.8701	3	14

Top

Potential FusionNeoAntigen Information of PITRM1-MAP3K7 in HLA II

PITRM1-MAP3K7_3187788_91260268.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	DRB1-0906	RRPVRPHTVEYFPGA	3	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	DRB1-1331	RRPVRPHTVEYFPGA	3	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	DRB1-1343	RRPVRPHTVEYFPGA	3	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	DRB1-1354	RRPVRPHTVEYFPGA	3	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	DRB1-1416	RRPVRPHTVEYFPGA	3	18
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	2492	DRB1-1512	PHTVEYFPGADEPLQ	8	23

Top

Fusion breakpoint peptide structures of PITRM1-MAP3K7

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10243	VRPHTVEYFPGADE	PITRM1	MAP3K7	chr10	3187788	chr6	91260268	2492

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PITRM1-MAP3K7

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10243	VRPHTVEYFPGADE	-7.9962	-8.1096
HLA-B14:02	3BVN	10243	VRPHTVEYFPGADE	-5.70842	-6.74372
HLA-B52:01	3W39	10243	VRPHTVEYFPGADE	-6.83737	-6.95077
HLA-B52:01	3W39	10243	VRPHTVEYFPGADE	-4.4836	-5.5189
HLA-A11:01	4UQ2	10243	VRPHTVEYFPGADE	-10.0067	-10.1201
HLA-A11:01	4UQ2	10243	VRPHTVEYFPGADE	-9.03915	-10.0745
HLA-A24:02	5HGA	10243	VRPHTVEYFPGADE	-6.56204	-6.67544
HLA-A24:02	5HGA	10243	VRPHTVEYFPGADE	-5.42271	-6.45801
HLA-B44:05	3DX8	10243	VRPHTVEYFPGADE	-7.85648	-8.89178
HLA-B44:05	3DX8	10243	VRPHTVEYFPGADE	-5.3978	-5.5112
HLA-B35:01	1A1N	10243	VRPHTVEYFPGADE	-6.27422	-6.38762
HLA-B35:01	1A1N	10243	VRPHTVEYFPGADE	-5.27424	-6.30954
HLA-A02:01	6TDR	10243	VRPHTVEYFPGADE	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of PITRM1-MAP3K7

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	11	21	VEYFPGADEP	GTCGAGTACTTTCCAGGAGCAGATGAGCCA
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	3	14	RRPVRPHTVEY	CGGAGGCCTGTGCGCCCACACACGGTCGAGTAC
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	4	14	RPVRPHTVEY	AGGCCTGTGCGCCCACACACGGTCGAGTAC
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	4	15	RPVRPHTVEYF	AGGCCTGTGCGCCCACACACGGTCGAGTACTTT
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	5	14	PVRPHTVEY	CCTGTGCGCCCACACACGGTCGAGTAC
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	6	14	VRPHTVEY	GTGCGCCCACACACGGTCGAGTAC
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	6	15	VRPHTVEYF	GTGCGCCCACACACGGTCGAGTACTTT
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	9	18	HTVEYFPGA	CACACGGTCGAGTACTTTCCAGGAGCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	3	18	RRPVRPHTVEYFPGA	CGGAGGCCTGTGCGCCCACACACGGTCGAGTACTTTCCAGGAGCA
PITRM1-MAP3K7	chr10	3187788	chr6	91260268	8	23	PHTVEYFPGADEPLQ	CCACACACGGTCGAGTACTTTCCAGGAGCAGATGAGCCATTACAG

Top

Information of the samples that have these potential fusion neoantigens of PITRM1-MAP3K7

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	PITRM1-MAP3K7	chr10	3187788	ENST00000224949	chr6	91260268	ENST00000369325	TCGA-EQ-8122-01A

Top

Potential target of CAR-T therapy development for PITRM1-MAP3K7

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PITRM1-MAP3K7

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PITRM1-MAP3K7

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)